Document rpagm2ZoBGZEnam7ZejE6nVQE

Original Article Advanced Rai Stage in Patients with Chronic Lymphocytic Leukaemia Correlates with Simultaneous Hypermethylation of Plural Tumour Suppressor Genes (chronic lymphocytic leukaemia / aberrant hypermethylation / tumour suppressor genes / Rai stage / methylation-specific polymerase chain reaction) K. FORSTEROV1, H. VOTAVOV1, J. SCHWARZ2, J. KARBAN1, C. STUKA1, M. TRNN1,2 1Charles University in Prague, First Faculty of Medicine, 1st Department of Medicine Clinical Department of Haematology of the First Faculty of Medicine and General University Hospital, Prague, Czech Republic 2Institute of Haematology and Blood Transfusion, Prague, Czech Republic Abstract. Hypermethylation of CpG islands within gene promoters is one of various mechanisms of gene silencing involved in the pathogenesis of human cancer. By using methylation-specific polymerase chain reaction we explored aberrant promoter methylation of five tumour suppressor genes in 29 patients with chronic lymphocytic leukaemia. Aberrant methylation of DLC1, SHP1, p15 and p16 occurred, respectively, in 89.7 %, 70 %, 62.1 % and 31 % of patients at diagnosis. Lamin A/C was unmethylated in all the samples. Hypermethylation of at least one gene was detected in 96.6 % of patients. Concurrent methylation of two or more genes correlated with Rai stage at diagnosis. Introduction Chronic lymphocytic leukaemia (CLL) is a common B-cell lymphoproliferative disorder characterized by variable clinical course. The extent of the disease in an individual is assessed by the staging system proposed by Rai et al. (1975) and Binet et al. (1981). In addition, a Received January 14, 2010. Accepted January 27, 2010. This work was supported by a grant of the Ministry of Education, Youth and Sports of the Czech Republic (MSM 0021620808). Corresponding author: Kristina Forsterov, Charles University in Prague, First Faculty of Medicine, 1st Department of Medicine Clinical Department of Haematology of the First Faculty of Medicine and General University Hospital, U Nemocnice 2, 128 08 Prague 2, Czech Republic. Phone: (+420) 224 962 685; Fax: (+420) 224 963 556; e-mail: kfors@lf1.cuni.cz Abbreviations: CLL chronic lymphocytic leukaemia, IgVH immunoglobulin heavy-chain variable region, MSP methylation-specific polymerase chain reaction, NHL non-Hodgkin lymphoma, PCR polymerase chain reaction, TSG tumour suppressor gene. Folia Biologica (Praha) 56, 158-164 (2010) number of biological prognostic factors have been described to discriminate between indolent and aggressive forms of CLL. These include cytogenetic aberrations (Dohner et al., 1997, 2000), immunoglobulin heavychain variable region (IgVH) gene mutational status, expression of CD38 (Damle et al., 1999; Hamblin et al., 1999, 2002; Thunberg et al., 2001; Krober et al., 2002; Oscier et al., 2002; Stilgenbauer et al., 2002; Guarini et al., 2003; Vasconcelos et al., 2003) and ZAP70 (Rosenwald et al., 2001; Crespo et al., 2003; Rassenti et al., 2004) proteins and expression of microRNAs (Calin et al., 2004; Chen and Lodish, 2005). DNA methylation, catalysed by DNA methyltransferases, involves the addition of a methyl group to the carbon-5 position of the cytosine ring in a CpG dinucleotide to become methylcytosine (Singal and Ginder, 1999; Baylin and Herman, 2000; Robertson and Wolffe, 2000; Chim et al., 2002). CpG dinucleotides are either scattered throughout the genome, or are found in stretches of CpG-rich DNA, referred to as CpG islands. CpG islands are mainly located at gene promoters where they are protected from methylation, so that these genes are in a transcription-ready state. On the other hand, nonpromoter CpG dinucleotides are found in repeat regions and are often methylated. Hypermethylation of CpG islands of the promoter region genes is associated with transcriptional inactivation and it is one of the mechanisms of tumour suppressor gene (TSG) inactivation (Herman and Baylin, 2003). Hypermethylation of CpG islands has been described in various tumour types, including CLL (Rush et al., 2004; Seeliger et al., 2009). Tumour suppressor genes may be inactivated by methylation, which may confer a growth advantage contributing to leukaemogenesis. The genes interesting from this point of view could be represented by two widely studied TSGs p15 and p16, lamin A/C, DLC1 and SHP1. It is well established that methylation of the promoters of these genes correlates with their reduced expression Vol. 56 Methylation in Chronic Lymphocytic Leukaemia 159 (Foster et al., 1998; Oka et al., 2002; Wong et al., 2003; Agrelo et al., 2005). p15 and p16 encode cyclin-dependent kinase inhibitors important for G1 cell cycle arrest (Hirama and Koeffler, 1995; Koh et al., 1995). A-type lamins are important in maintaining the stability of nuclear lamina, and they also have a central role in maintaining the function of transcription factors required for the differentiation of adult stem cells (Hutchison and Worman, 2004). Mutations in the lamin A/C gene have been shown to cause several tissue-specific inherited diseases, such as Emery-Dreifuss muscular dystrophy or Dunnigan-type familial partial lipodystrophy (Broers et al., 2004). Its hypermethylation was detected in patients with diffuse large B-cell lymphoma (Agrelo et al., 2005). DLC1 (deleted in liver cancer) is considered as a potential tumour suppressor, its hypermethylation was detected in several leukaemia and lymphoma types (Shi et al., 2007; Ying et al., 2007; Pike et al., 2008). SHP1 is expressed primarily in haematopoietic cells (Oka et al., 2002). SHP1 acts as a growth inhibitor in B cells by down-regulating the intracellular effects of immunoglobulin binding, thus requiring multiple receptor binding to initiate B-cell activation and proliferation (Cyster and Goodnow, 1995; Pani et al., 1995). B lymphocytes with decreased SHP1 activity are thus more likely to proliferate and escape apoptosis (Cyster and Goodnow, 1995; Pani et al., 1995). SHP1 hypermethylation was described in several haematologic malignancies (Koyama et al., 2003; Chim et al., 2004; Reddy et al., 2005; Amara et al., 2007, 2008; Chim et al., 2007). In this study, we investigated the frequency of methylation of the above-mentioned genes showing the DLC1 gene to be extensively methylated in CLL. The clinicopathological and prognostic impacts of aberrant gene methylation in CLL were also examined. We have found that patients with advanced Rai stage at diagnosis usually carry several methylated genes concurrently. Material and Methods Patients Twenty-nine patients (20 males and 9 females, median age 55.7, range 4469 years) with CLL were in- cluded into the analysis. All the patients enrolled in this study had immunophenotypically defined B-CLL as outlined by the modified 1996 NCI criteria (Cheson et al., 1996). The clinical stage was evaluated according to Rai et al. (1975). There were three (10.3 %) stage 0, twelve (41.4 %) stage I, eight (27.6 %) stage II, five (17.2 %) stage III and one (3.5 %) stage IV patients by Rai staging system. Of 23 patients with a known mutational status, 22 had unmutated IgVH genes. This bias in the mutational status was due to primary selection of patients who needed treatment with immunochemotherapy. Methylation-specific polymerase chain reaction (MSP) DNA was extracted from samples using the saltingout method (Miller et al., 1988). DNA was modified by bisulphite reaction using the EpiTect DNA Modification kit (Qiagen, Hilden, Germany). After completion of the reaction, all unmethylated cytosines were deaminated and converted to uracil, while methylated cytosines remained unchanged. Primer sequences for the methylated and unmethylated alleles were as previously published for p15, p16 (Herman et al., 1996), SHP1 (Oka et al., 2002), DLC1 (Wong et al., 2003) and lamin A/C (Agrelo et al., 2005) (Table 1). The polymerase chain reaction (PCR) mixture contained 2 l of bisulphite-treated DNA, 0.2 mM dNTPs, 2 mM MgCl2, 300 nM of each primer, 1x PCR buffer II and 1.5 units of AmpliTaq Gold (PE Biosystems, Foster City, CA) in a final volume of 30 l. PCR conditions were as follows: 95 C for 5 min followed by 35 cycles of 95 C for 30 s, annealing temperature (specified for each primer pair in Table 1) for 30 s, 72 C for 90 s, and finally 5 min at 72 C. PCR products were separated in 10 % non-denaturing polyacrylamide gel and visualized by ethidium bromide staining. All tests were performed in duplicate. Each MSP reaction contained a positive control with methylated DNA, a negative control with DNA from 30 normal donors and reagent blanks. The sensitivity of MSP was estimated by serial 10-fold dilution of methylated DNA in normal donor DNA, followed by bisulphite modification and amplification by MSP, and was found to be 1 103 for DLC1, p16 and SHP1, and 1 104 for p15. Table 1. Sequences of PCR primers. M-methylated, U-unmethylated Gene Forward primer p15-M p15-U p16-M p16-U SHP-1-M SHP-1-U DLC-1-M DLC-1-U lamin-M lamin-U GCGTTCGTATTTTGCGGTT TGTGATGTGTTTGTATTTTGTGGTT TTATTAGAGGGTGGGGCGGATCGC TTATTAGAGGGTGGGGTGGATTGT GAACGTTATTATAGTATAGCGTTC GTG AAT GTT ATT ATA GTA TAG TGT TTG G TTT AAA GAT CGAAAC GAG GGA GCG TTT TTT AAA GAT TGA AAT GAG GGA GTG TTA TTA GAG TTT TTG TTT CGG CGT C AGG ATT TAT TAG AGT TTT TGT TTT GGT GTT Ann. t. annealing temperature Reverse primer Ann. t., C CGTACAATAACCGAACGACCGA CCATACAATAACCAAACAACCAA GACCCCGAACCGCGACCGTAA CAACCCCAAACCACAACCATAA TCACGCATACGAACCCAAACG TTC ACA CAT ACAAAC CCA AAC AAT CCC AAC GAA AAA ACC CGACTA ACG AAA CCC AAC AAA AAA ACC CAA CTA ACA CGC CGA CCG ACT AAC TCT CG CAA AAT ACA CCA ACC AAC TAA CTC TCA 60 60 65 60 60 59 55 58 60 60 160 K. Forsterov et al. Vol. 56 Statistical analysis The Spearman test was performed to statistically evaluate the correlations between the methylation level of individual genes and their combinations and the patients' clinical characteristics such as clinical stage at diagnosis, age, sex, and CD38 expression. We used the log-rank test of Kaplan-Meier to determine the association between hypermethylation of individual genes and overall survival. P < 0.05 was considered statistically significant. Results MSP in primary CLL marrow samples We determined CpG island methylation at five loci in bone marrow samples from 29 patients with chronic lymphocytic leukaemia. Thirty normal peripheral blood donors were tested and the results were all negative for methylation of all the genes studied. The methylation patterns varied grossly in individual patients. Of the 29 marrow samples, 28 (96.6 %) showed promoter methylation of at least one gene, with a maximum of four methylated genes. Four samples showed methylation at one gene, six at two genes, fifteen at three genes, and three at four genes. A high proportion of samples (89.7 %) were methylated at the DLC1 (Fig. 1) locus, whereas 70 %, 62.1 % and 31 % were methylated at the SHP1, p15 and p16 loci, respectively. In contrast, none of the patients showed methylation of the lamin A/C gene. Correlation of clinicopathological characteristics and MSP We compared molecular and clinicopathological features of CLL patients. We found a good correlation between methylation of DLC1 and p15 genes (P = 0.0182). In addition, there was a statistically significant correlation between Rai stage at diagnosis and simultaneous methylation of two or more genes. Fig. 1. M-MSP of the DLC1 gene. Lane 1: positive sample, Lane 2: negative sample, Lane 3: marker, Lane 4: negative control from healthy donors, Lane 5: positive control (in vitro methylated DNA). We used Spearman test to analyse whether any of the methylated genes or their different combinations might predict patient's clinical stage of the disease. Our results showed that the potency to predict higher Rai stage at diagnosis is possessed by only two or better three simultaneously methylated genes. When considering simultaneous methylation of two genes, the most predictive combination of genes was SHP1 and p15 (P = 0.0445). In the case of simultaneous methylation of three genes, the most suitable was the hypermethylation pattern of SHP1, p15 and p16 (P = 0.0165). Moreover, when dichotomizing Rai stage into two groups, Rai 0, I versus Rai II-IV, an even better correlation was observed between dichotomic Rai stage and concurrent methylation of the couple of methylated genes SHP1 and p15 (P = 0.0153) and the triad of genes p15, p16 and SHP1 (P = 0.0015) (Table 2). The strongest correlation was found between dichotomic Rai stage and simultaneous methylation of at least any three genes (P = 0.0004), e.g. patients in higher Rai stage tended to have multiple methylated genes (Fig. 2). No association was identified between the patterns of aberrant gene methylation and other clinicopathological features at presentation, including age, sex and CD38 expression. There was no significant impact of DLC1, SHP1, p15 and p16 methylation on the median overall survival of the 29 CLL patients studied (data not shown). Discussion We have studied the methylation profile of a panel of five tumour suppressor genes as well as the correlation of these aberrant methylations with clinicopathological characteristics in a pilot cohort of patients with CLL. We found that DLC1, SHP1 and p15 genes were fre- Table 2. Statistical significance of the correlation between the dichotomized Rai stage and methylated genes. r Spearman's coefficient Methylated gene (combination of genes) SHP1 DLC1 p15 p16 SHP1+DLC1 SHP1+p15 SHP1+p16 DLC1+p15 DLC1+p16 p15+p16 SHP1+DLC1+p15 SHP1+DLC1+p16 SHP1+p15+p16 DLC1+p15+p16 SHP1+DLC1+p15+p16 more than two genes Statistical significance of Spearman's rank correlation coefficient r P value 0.350 0.328 0.329 0.247 0.424 0.446 0.429 0.364 0.385 0.439 0.464 0.500 0.563 0.479 0.568 0.613 0.0629 0.0822 0.0818 0.1967 0.0217 0.0153 0.0202 0.0519 0.0392 0.0172 0.0113 0.0058 0.0015 0.0086 0.0013 0.0004 Vol. 56 Methylation in Chronic Lymphocytic Leukaemia 161 Fig. 2. Correlation between the dichotomized Rai stage at diagnosis and the number of methylated genes. quently methylated in CLL, whereas p16 was methylated with lower frequency and lamin A/C was unmethylated in all the patients. None of the normal control peripheral blood samples showed methylation of any of the genes tested. The highest frequency of methylation was detected in the DLC1 gene. It was identified as a candidate tumour suppressor and its expression was lost or downregulated in various cancers, including liver, breast, lung, brain, stomach, colon and prostate cancers due to either genomic deletion or aberrant DNA methylation (Yuan et al., 1998, 2003, 2004; Ng et al., 2000; Kim et al., 2003, 2007; Plaumann et al., 2003; Wong et al., 2003; Guan et al., 2006; Ullmannova and Popescu, 2006, Song et al., 2006; Seng et al., 2007). Its aberrant methylation was also detected in 6090 % of various types of primary non-Hodgkin lymphomas (NHLs) (Shi et al., 2007; Ying et al., 2007). As yet, no data on DLC1 methylation in CLL are available in the literature. We found this gene to be aberrantly hypermethylated in 89.7 % of CLL patients. The high frequency of DLC1 methylation found in our study implied that it might play a role in leukaemogenesis. SHP1 was another frequently methylated gene. It has been shown to be frequently silenced in leukaemias, lymphomas and multiple myeloma (Zhang et al., 2000; Oka et al., 2002), but no study has addressed SHP1 methylation in CLL specifically. In our study, 70 % of patients had methylation of the SHP1 promoter. This frequency was comparable with previous reports that demonstrated SHP1 methylation in 94 % in leukaemias (Reddy et al., 2005) and in 75100 % in NHLs (Koyama et al., 2003; Reddy et al., 2005). p15 and p16 are two closely linked tumour suppressor genes located at 9p21 (Kamb et al., 1994; Nobori et al., 1994). In human cancers, p16 is frequently inactivated by homozygous deletion, point mutations or methylation of its promoter region (Cairns et al., 1995; Herman et al., 1995). p15 is often homozygously co-deleted in solid tumours with homozygous deletion of p16 (Chim et al., 2002). In haematologic malignancies, p15 is frequently methylated in several leukaemias and rarely in lymphoma, while promoter methylation of p16 is common in lymphoma but rarely seen in leukaemia (Herman et al., 1997). In CLL, methylation of both p15 and p16 has been detected with lower frequency than in our study. Previous studies found the p15 promoter to be methylated in 1235 % (Chim et al., 2006; Papageorgiou et al., 2007) of patients and methylation of p16 has been found in less than 20 % of cases (Martel et al., 1997; Chim et al., 2006; Tsirigotis et al., 2006). In the present study, we found that 62 % and 31 % of CLL patients exhibit methylation of p15 and p16, respectively. The lamin A/C gene encodes the lamins A and C. It has been described that the expression of the A-type lamins is reduced or absent in subsets of cells with a low degree of differentiation and/or cells that are highly proliferating (Rober et al., 1989; Broers et al., 1997), including human malignancies (Hutchison and Worman, 2004), especially leukaemias and lymphomas (Stadelmann et al., 1990; Lin and Worman, 1997). Hypermethylation of lamin A/C was found to be associated with poor outcome in diffuse large B-cell lymphoma (Agrelo et al., 2005). However, none of CLL patients in our study showed methylation of this gene. We have correlated aberrant methylation of the abovementioned genes with several clinicopathological features of patients, including age, sex, CD38 expression, Rai stage at diagnosis and overall survival. We found a correlation between methylation patterns of two genes, p15 and DLC1. Moreover, we found that simultaneous methylation of at least two genes correlated with Rai stage at diagnosis. In addition, we identified optimal combination of two genes (SHP1, p15) and of three genes (SHP1, p15, p16) of the analysed genes to predict this correlation. These data suggest that progression of the disease is associated with epigenetic deregulation of various regulatory pathways in CLL. In summary, the DLC1 gene is methylated in the majority of CLL patients. Patients with advanced Rai stage 162 K. Forsterov et al. Vol. 56 at diagnosis tend to have simultaneously more methylated genes, suggesting that increasing methylation of tumour suppressor genes may contribute to disease evolution, or, at least, might reflect the molecular pathogenesis of CLL. As the number of patients in our study was small, our observations must be validated in future prospective studies with larger numbers of patients. Acknowledgements We thank J. Blcek for performing statistical analysis. References Agrelo, R., Setien, F., Espada, J., Artiga, M. J., Rodriguez, M., Perez-Rosado, A., Sanchez-Aguilera, A., Fraga, M. F., Piris, M. A., Esteller, M. (2005) Inactivation of the lamin A/C gene by CpG island promoter hypermethylation in hematologic malignancies, and its association with poor survival in nodal diffuse large B-cell lymphoma. J. Clin. Oncol. 23, 3940-3947. Amara, K., Trimeche, M., Ziadi, S., Laatiri, A., Hachana, M., Sriha, B., Mokni, M., Korbi, S. (2007) Presence of simian virus 40 DNA sequences in diffuse large B-cell lymphomas in Tunisia correlates with aberrant promoter hypermethylation of multiple tumor suppressor genes. Int. J. Cancer 121, 2693-2702. Amara, K., Trimeche, M., Ziadi, S., Laatiri, A., Hachana, M. Korbi, S. (2008) Prognostic significance of aberrant promoter hypermethylation of CpG islands in patients with diffuse large B-cell lymphomas. Ann. Oncol. 19, 17741786. Baylin, S. B., Herman, J. G. (2000) DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet. 16, 168-174. Binet, J. L., Auquier, A., Dighiero, G., Chastang, C., Piguet, H., Goasguen, J., Vaugier, G., Potron, G., Colona, P., Oberling, F., Thomas, M., Tchernia, G., Jacquillat, C., Boivin, P., Lesty, C., Duault, M. T., Monconduit, M., Belabbes, S., Gremy, F. (1981) A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer 48, 198-206. Broers, J. L., Machiels, B. M., Kuijpers, H. J., Smedts, F., van den Kieboom, R., Raymond, Y., Ramaekers, F. C. (1997) A- and B-type lamins are differentially expressed in normal human tissues. Histochem. Cell Biol. 107, 505-517. Broers, J. L., Hutchison, C. J., Ramaekers, F. C. (2004) Laminopathies. J. Pathol. 204, 478-488. Cairns, P., Polascik, T. J., Eby, Y., Tokino, K., Califano, J., Merlo, A., Mao, L., Herath, J., Jenkins, R., Westra, W., Rutter, J. L., Buckler, A., Gabrielson, E., Tockman, M., Cho, K. R., Hedrick, L., Bova, G. S., Issacs, W., Schwab, D., Sidransky, D. (1995) Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nat. Genet. 11, 210-212. Calin, G. A., Liu, C. G., Sevignani, C., Ferracin, M., Felli, N., Dumitru, C. D., Shimizu, M., Cimmino, A., Zupo, S., Dono, M., Dell'Aquila, M. L, Alder, H., Rassenti, L., Kipps, T. J., Bullrich, F., Negrini, M., Croce, C. M. (2004) MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc. Natl. Acad. Sci. USA 101, 11755-11760. Chen, C. Z., Lodish, H. F. (2005) MicroRNAs as regulators of mammalian hematopoiesis. Semin. Immunol. 17, 155-165. Cheson, B. D., Bennett, J. M., Grever, M., Kay, N., Keating, M. J., O'Brien, S., Rai, K. R. (1996) National Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment. Blood 87, 4990-4997. Chim, C. S., Liang, R., Kwong, Y. L. (2002) Hypermethylation of gene promoters in hematological neoplasia. Hematol. Oncol. 20, 167-176. Chim, C. S., Wong, K. Y., Loong, F., Srivastava, G. (2004) SOCS1 and SHP1 hypermethylation in mantle cell lymphoma and follicular lymphoma: implications for epigenetic activation of the Jak/STAT pathway. Leukemia 18, 356-358. Chim, C. S., Fung, T. K., Wong, K. F., Lau, J. S., Law, M., Liang, R. (2006) Methylation of INK4 and CIP/KIP families of cyclin-dependent kinase inhibitor in chronic lymphocytic leukaemia in Chinese patients. J. Clin. Pathol. 59, 921-926. Chim, C. S., Liang, R., Leung, M. H., Kwong, Y. L. (2007) Aberrant gene methylation implicated in the progression of monoclonal gammopathy of undetermined significance to multiple myeloma. J. Clin. Pathol. 60, 104-106. Crespo, M., Bosch, F., Villamor, N., Bellosillo, B., Colomer, D., Rozman, M., Marc, S., Lpez-Guillermo, A., Campo, E., Montserrat, E. (2003) ZAP-70 expression as a surrogate for immunoglobulin-variable-region mutations in chronic lymphocytic leukemia. N. Engl. J. Med. 348, 1764-1775. Cyster, J. G., Goodnow, C. C. (1995) Protein tyrosine phosphatase 1C negatively regulates antigen receptor signaling in B lymphocytes and determines thresholds for negative selection. Immunity 2, 13-24. Damle, R. N., Wasil, T., Fais, F., Ghiotto, F., Valetto, A., Allen, S. L., Buchbinder, A., Budman, D., Dittmar, K., Kolitz, J., Lichtman, S. M., Schulman, P., Vinciguerra, V. P., Rai, K. R., Ferrarinni, M., Chiorazzi, N. (1999) IgV gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood 94, 1840-1847. Dohner, H., Stilgenbauer, S., James, M. R., Benner, A., Weilguni, T., Bentz, M. Fischer, K., Hunstein, W., Lichter, P. (1997) 11q deletions identify a new subset of B-cell chronic lymphocytic leukemia characterized by extensive nodal involvement and inferior prognosis. Blood, 89, 2516-2522. Dohner, H., Stilgenbauer, S., Benner, A., Leupolt, E., Krober, A., Bullinger, L., Dhner, K., Bentz, M., Lichter, P. (2000) Genomic aberrations and survival in chronic lymphocytic leukemia. N. Engl. J. Med. 343, 1910-1916. Foster, S. A., Wong, D. J., Barrett, M. T., Galloway, D. A. (1998) Inactivation of p16 in human mammary epithelial cells by CpG island methylation. Mol. Cell. Biol. 18, 17931801. Guan, M., Zhou, X., Soulitzis, N., Spandidos, D. A., Popescu, N. C. (2006) Aberrant methylation and deacetylation of deleted in liver cancer-1 gene in prostate cancer: potential clinical applications. Clin. Cancer Res. 12, 1412-1419. Vol. 56 Methylation in Chronic Lymphocytic Leukaemia 163 Guarini, A., Gaidano, G., Mauro, F. R., Capello, D., Mancini, F., De Propris, M. S., Mancini, M., Orsini, E., Gentile, M., Breccia, M., Cuneo, A., Castoldi, G., Foa, R.. (2003) Chronic lymphocytic leukemia patients with highly stable and indolent disease show distinctive phenotypic and genotypic features. Blood 102, 1035-1041. Hamblin, T. J., Davis, Z., Gardiner, A., Oscier, D. G., Stevenson, F. K. (1999) Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 94, 1848-1854. Hamblin, T. J., Orchard, J. A., Ibbotson, R. E., Davis, Z., Thomas, P. W., Stevenson, F. K., Oscier, D. G. (2002) CD38 expression and immunoglobulin variable region mutations are independent prognostic variables in chronic lymphocytic leukemia, but CD38 expression may vary during the course of the disease. Blood, 99 1023-1029. Herman, J. G., Merlo, A., Mao, L., Lapidus, R. G., Issa, J. P., Davidson, N. E., Sidransky, D., Baylin, S. B. (1995) Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res. 55, 4525-4530. Herman, J. G., Graff, J. R., Myohanen, S., Nelkin, B. D., Baylin, S. B. (1996) Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA 93, 9821-9826. Herman, J. G., Civin, C. I., Issa, J. P., Collector, M. I., Sharkis, S. J., Baylin, S. B. (1997) Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the major types of hematological malignancies. Cancer Res. 57, 837-841. Herman, J. G., Baylin, S. B. (2003) Gene silencing in cancer in association with promoter hypermethylation. N. Engl. J. Med. 349, 2042-2054. Hirama, T., Koeffler, H. P. (1995) Role of the cyclin-dependent kinase inhibitors in the development of cancer. Blood 86, 841-854. Hutchison, C. J., Worman, H. J. (2004) A-type lamins: guardians of the soma? Nat. Cell Biol. 6, 1062-1067. Kamb, A., Gruis, N. A., Weaver-Feldhaus, J., Liu, Q., Harshman, K., Tavtigian, S. V., Stockert, E., Day, R. S. 3rd, Johnson, B. E., Skolnick, M. H. (1994) A cell cycle regulator potentially involved in genesis of many tumor types. Science 264, 436-440. Kim, T. Y., Jong, H. S., Song, S. H., Dimtchev, A., Jeong, S. J., Lee, J. W., Kim, T. Y., Kim, N. K., Jung, M., Bang, Y. J. (2003) Transcriptional silencing of the DLC1 tumor suppressor gene by epigenetic mechanism in gastric cancer cells. Oncogene 22, 3943-3951. Kim, T. Y., Lee, J. W., Kim, H. P., Jong, H. S., Kim, T. Y., Jung, M., Bang, Y. J. (2007) DLC1, a GTPase-activating protein for Rho, is associated with cell proliferation, morphology, and migration in human hepatocellular carcinoma. Biochem. Biophys. Res. Commun. 355, 72-77. Koh, J., Enders, G. H., Dynlacht, B. D. and Harlow, E. (1995) Tumour-derived p16 alleles encoding proteins defective in cell-cycle inhibition. Nature 375, 506-510. Koyama, M., Oka, T., Ouchida, M., Nakatani, Y., Nishiuchi, R., Yoshino, T., Hayashi, K., Akagi, T., Seino, Y. (2003) Activated proliferation of B-cell lymphomas/leukemias with the SHP1 gene silencing by aberrant CpG methylation. Lab. Invest. 83, 1849-1858. Krober, A., Seiler, T., Benner, A., Bullinger, L., Bruckle, E., Lichter, P., Dhner, H., Stilgenbauer, S. (2002) V(H) mutation status, CD38 expression level, genomic aberrations, and survival in chronic lymphocytic leukemia. Blood 100, 1410-1416. Lin, F., Worman, H. J. (1997) Expression of nuclear lamins in human tissues and cancer cell lines and transcription from the promoters of the lamin A/C and B1 genes. Exp. Cell Res. 236, 378-384. Martel, V., Guerci, A., Humbert, J. C., Gregoire, M. J., Chery, M., Lederlin, P., Jonveaux, P. (1997) De novo methylation of tumour suppressor genes CDKN2A and CDKN2B is a rare finding in B-cell chronic lymphocytic leukaemia. Br. J. Haematol. 99, 320-324. Miller, S. A., Dykes, D. D., Polesky, H. F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16, 1215. Ng, I. O., Liang, Z. D., Cao, L., Lee, T. K. (2000) DLC1 is deleted in primary hepatocellular carcinoma and exerts inhibitory effects on the proliferation of hepatoma cell lines with deleted DLC1. Cancer Res. 60, 6581-6584. Nobori, T., Miura, K., Wu, D. J., Lois, A., Takabayashi, K., Carson, D. A. (1994) Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature 368, 753-756. Oka, T., Ouchida, M., Koyama, M., Ogama, Y., Takada, S., Nakatani, Y., Tanaka, T., Yoshino, T., Hayashi, K., Ohara, N., Kondo, E., Takahashi, K., Tsuchiyama, J., Tanimoto, M., Shimizu, K., Akagi, T. (2002) Gene silencing of the tyrosine phosphatase SHP1 gene by aberrant methylation in leukemias/lymphomas. Cancer Res. 62, 6390-6394. Oscier, D. G., Gardiner, A. C., Mould, S. J., Glide, S., Davis, Z. A., Ibbotson, R. E., Corcoran, M. M., Chapman, R. M., Thomas, P., Copplestone, J. A., Orchard, J. A., Hamblin, T. J.H., (2002) Multivariate analysis of prognostic factors in CLL: clinical stage, IGVH gene mutational status, and loss or mutation of the p53 gene are independent prognostic factors. Blood 100, 1177-1184. Pani, G., Kozlowski, M., Cambier, J. C., Mills, G. B., Siminovitch, K. A. (1995) Identification of the tyrosine phosphatase PTP1C as a B cell antigen receptor-associated protein involved in the regulation of B cell signaling. J. Exp. Med. 181, 2077-2084. Papageorgiou, S. G., Lambropoulos, S., Pappa, V., Economopoulou, C., Kontsioti, F., Papageorgiou, E., Tsirigotis P, Dervenoulas, J., Economopoulos, T. (2007) Hypermethylation of the p15INK4B gene promoter in Bchronic lymphocytic leukemia. Am. J. Hematol. 82, 824825. Pike, B. L., Greiner, T. C., Wang, X., Weisenburger, D. D., Hsu, Y. H., Renaud, G., Wolfsberg, T. G., Kim, M., Weisenberger, D. J., Siegmund, K. D., Ye, W., Groshen, S., Mehrian-Shai, R., Delabie, J., Chan, W. C., Laird, P. W., Hacia, J. G. (2008) DNA methylation profiles in diffuse large B-cell lymphoma and their relationship to gene expression status. Leukemia 22, 1035-1043. Plaumann, M., Seitz, S., Frege, R., Estevez-Schwarz, L., Scherneck, S. (2003) Analysis of DLC1 expression in human breast cancer. J. Cancer Res. Clin. Oncol. 129, 349354. 164 K. Forsterov et al. Vol. 56 Rai, K. R., Sawitsky, A., Cronkite, E. P., Chanana, A. D., Levy, R. N., Pasternack, B. S. (1975) Clinical staging of chronic lymphocytic leukemia. Blood 46, 219-234. Rassenti, L. Z., Huynh, L., Toy, T. L., Chen, L., Keating, M. J., Gribben, J. G., Neuberg, D. S., Flinn, I. W., Rai, K. R., Byrd, J. C., Kay, N. E., Greaves, A., Weiss, A., Kipps, T. J. (2004) ZAP-70 compared with immunoglobulin heavychain gene mutation status as a predictor of disease progression in chronic lymphocytic leukemia. N. Engl. J. Med. 351, 893-901. Reddy, J., Shivapurkar, N., Takahashi, T., Parikh, G., Stastny, V., Echebiri, C., Crumrine, K., Zchbauer-Mller, S., Drach, J., Zheng, Y., Feng, Z., Kroft, S. H., McKenna, R. W., Gazdar, A. F. (2005) Differential methylation of genes that regulate cytokine signaling in lymphoid and hematopoietic tumors. Oncogene 24, 732-736. Rober, R. A., Weber, K., Osborn, M. (1989) Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development 105, 365-378. Robertson, K. D., Wolffe, A. P. (2000) DNA methylation in health and disease. Nat. Rev. Genet. 1, 11-19. Rosenwald, A., Alizadeh, A. A., Widhopf, G., Simon, R., Davis, R. E., Yu, X., Yang, L., Pickeral, O. K., Rassenti, L. Z., Powell, J., Botstein, D., Byrd, J. C., Grever, M. R., Cheson, B. D., Chiorazzi, N., Wilson, W. H., Kipps, T. J., Brown, P. O., Staudt, L. M. (2001) Relation of gene expression phenotype to immunoglobulin mutation genotype in B cell chronic lymphocytic leukemia. J. Exp. Med. 194, 1639-1647. Rush, L. J., Raval, A., Funchain, P., Johnson, A. J., Smith, L., Lucas, D. M., Bembea, M., Liu, T. H., Heerema, N. A., Rassenti, L., Liyanarachchi, S., Davuluri, R., Byrd, J. C., Plass, C. (2004) Epigenetic profiling in chronic lymphocytic leukemia reveals novel methylation targets. Cancer Res. 64, 2424-2433. Seeliger, B., Wilop, S., Osieka, R., Galm, O., Jost, E. (2009) CpG island methylation patterns in chronic lymphocytic leukemia. Leuk. Lymphoma 50, 419-426. Seng, T. J., Low, J. S., Li, H., Cui, Y., Goh, H. K., Wong, M. L., Srivastava, G., Sidransky, D., Califano, J., Steenbergen, R. D., Rha, S. Y., Tan, J., Hsieh, W. S., Ambinder, R. F., Lin, X., Chan, A. T., Tao, Q. (2007) The major 8p22 tumor suppressor DLC1 is frequently silenced by methylation in both endemic and sporadic nasopharyngeal, esophageal, and cervical carcinomas, and inhibits tumor cell colony formation. Oncogene 26, 934-944. Shi, H., Guo, J., Duff, D. J., Rahmatpanah, F., ChitimaMatsiga, R., Al-Kuhlani, M., Taylor, K. H., Sjahputera, O., Andreski, M., Wooldridge, J. E., Caldwell, C. W. (2007) Discovery of novel epigenetic markers in non-Hodgkin's lymphoma. Carcinogenesis 28, 60-70. Singal, R., Ginder, G. D. (1999) DNA methylation. Blood 93, 4059-4070. Song, Y. F., Xu, R., Zhang, X. H., Chen, B. B., Chen, Q., Chen, Y. M., Xie, Y. (2006) High-frequency promoter hypermethylation of the deleted in liver cancer-1 gene in multiple myeloma. J. Clin. Pathol. 59, 947-951. Stadelmann, B., Khandjian, E., Hirt, A., Luthy, A., Weil, R., Wagner, H. P. (1990) Repression of nuclear lamin A and C gene expression in human acute lymphoblastic leukemia and non-Hodgkin's lymphoma cells. Leuk. Res. 14, 815821. Stilgenbauer, S., Bullinger, L., Lichter, P., Dohner, H. (2002) Genetics of chronic lymphocytic leukemia: genomic aberrations and V(H) gene mutation status in pathogenesis and clinical course. Leukemia 16, 993-1007. Thunberg, U., Johnson, A., Roos, G., Thorn, I., Tobin, G., Sallstrom, J., Sundstrm, C., Rosenquist, R. (2001) CD38 expression is a poor predictor for VH gene mutational status and prognosis in chronic lymphocytic leukemia. Blood 97, 1892-1894. Tsirigotis, P., Pappa, V., Labropoulos, S., Papageorgiou, S., Kontsioti, F., Dervenoulas, J., Papageorgiou, E., Panani, A., Mantzios, G., Economopoulos, T., Raptis, S. (2006) Mutational and methylation analysis of the cyclin-dependent kinase 4 inhibitor (p16INK4A) gene in chronic lymphocytic leukemia. Eur. J. Haematol. 76, 230-236. Ullmannova, V., Popescu, N. C. (2006) Expression profile of the tumor suppressor genes DLC1 and DLC-2 in solid tumors. Int. J. Oncol. 29, 1127-1132. Vasconcelos, Y., Davi, F., Levy, V., Oppezzo, P., Magnac, C., Michel, A., Yamamoto, M,, Pritsch, O., Merle-Bral, H., Maloum, K., Ajchenbaum-Cymbalista, F., Dighiero, G. (2003) Binet's staging system and VH genes are independent but complementary prognostic indicators in chronic lymphocytic leukemia. J. Clin. Oncol. 21, 3928-3932. Wong, C. M., Lee, J. M., Ching, Y. P., Jin, D. Y., Ng, I. O. (2003) Genetic and epigenetic alterations of DLC1 gene in hepatocellular carcinoma. Cancer Res. 63, 7646-7651. Ying, J., Li, H., Murray, P., Gao, Z., Chen, Y. W., Wang, Y., Lee, K. Y., Chan, A. T., Ambinder, R. F., Srivastava, G., Tao, Q. (2007) Tumor-specific methylation of the 8p22 tumor suppressor gene DLC1 is an epigenetic biomarker for Hodgkin, nasal NK/T-cell and other types of lymphomas. Epigenetics 2, 15-21. Yuan, B. Z., Miller, M. J., Keck, C. L., Zimonjic, D. B., Thorgeirsson, S. S., Popescu, N. C. (1998) Cloning, characterization, and chromosomal localization of a gene frequently deleted in human liver cancer (DLC1) homologous to rat RhoGAP. Cancer Res. 58, 2196-2199. Yuan, B. Z., Durkin, M. E., Popescu, N. C. (2003) Promoter hypermethylation of DLC1, a candidate tumor suppressor gene, in several common human cancers. Cancer Genet. Cytogenet. 140, 113-117. Yuan, B. Z., Jefferson, A. M., Baldwin, K. T., Thorgeirsson, S. S., Popescu, N. C., Reynolds, S. H. (2004) DLC1 operates as a tumor suppressor gene in human non-small cell lung carcinomas. Oncogene 23, 1405-1411. Zhang, Q., Raghunath, P. N., Vonderheid, E., Odum, N., Wasik, M. A. (2000) Lack of phosphotyrosine phosphatase SHP1 expression in malignant T-cell lymphoma cells results from methylation of the SHP1 promoter. Am. J. Pathol. 157, 1137-1146.