Document q3aXYrGEjVoOZMp3ZRexrXbpM

GENES, CHROMOSOMES & CANCER 37:36 43 (2003) Prenatal Origin of TEL-AML1Positive Acute Lymphoblastic Leukemia in Children Born in California Cliona M. McHale,1 Joseph L. Wiemels,2 Luoping Zhang,1 Xiaomei Ma,1 Patricia A. Buffler,1 Weihong Guo,1 Mignon L. Loh,3 and Martyn T. Smith1* 1School of Public Health, University of California, Berkeley, California 2Laboratory for Molecular Epidemiology, Department of Epidemiology and Biostatistics, University of California, San Francisco, California 3Department of Pediatrics, University of California, San Francisco, California Acute lymphoblastic leukemia (ALL) is the most common form of childhood cancer. The peak incidence of ALL between ages 2 and 5 is accounted for by one subtype, referred to as common acute lymphoblastic leukemia (cALL). About 25% of cALL patients have the TEL-AML1 gene fusion derived from the t(12;21) chromosomal translocation. Recent evidence from retrospective analysis of neonatal blood spots (Guthrie cards) in Europe has demonstrated that this chromosome translocation may arise prenatally. The aim of our study was to determine whether TEL-AML1 fusions arise prenatally in a U.S. population of cALL patients. TEL-AML1positive cALL cases (n 14) were identified by fluorescence in situ hybridization, and the genomic breakpoints were identified by a streamlined long-distance PCR approach and sequenced. Clonotypic primers were designed for each patient breakpoint, and a nested PCR assay was used to determine the presence of the TEL-AML1 fusion sequence in neonatal Guthrie cards. Seven of 14 cases demonstrated clonotypic sequences on the archival Guthrie cards. The oldest patient that was positive was 6.7 years old at the time of diagnosis of leukemia. These results confirm previously published findings of a prenatal origin of TEL-AML1 in Europe by demonstrating its occurrence in a California-born population. Secondary changes were also similar to those described previously, with deletion of the second TEL allele being the most common. Other secondary changes included duplication of the fusion gene, trisomy 21, and monosomy X. 2003 Wiley-Liss, Inc. INTRODUCTION As with other types of cancer, leukemia is a heterogeneous disease whereby nonrandom genetic aberrations, such as chromosomal translocations, are complemented by secondary genetic aberrations that give rise to leukemic clones. In infant leukemia and common acute lymphoblastic leukemia (cALL) of early childhood, all of the molecular changes necessary to generate disease occur within a relatively narrow time frame, affording an opportunity for investigation of the etiology of such leukemias. Compelling evidence has demonstrated that chromosomal translocations are early events in leukemogenesis, occurring in utero. Initially, studies in twins with concordant leukemia demonstrated an in utero origin for infant leukemia characterized by MLL rearrangements (Ford et al., 1993; Gill Super et al., 1994) and cALL characterized by t(12;21) TEL-AML1 rearrangements (Ford et al., 1998; Wiemels et al., 1999b). More direct evidence for an in utero origin of specific translocations was provided by retrospective scrutiny of neonatal Guthrie blood spots for the presence of patient- specific chromosomal translocations, including MLL (Gale et al., 1997) and TEL-AML1 (Wiemels et al., 1999a; Maia et al., 2001). Indirect support for a prenatal origin of several ALL cases lacking specific chromosomal translocations was provided by tracking clonotypic IGH and TCR rearrangements including cALL (Yagi et al., 2000), T-ALL (Fasching et al., 2000), and hyperdiploid ALL (Taub et al., 2002). The TEL-AML1 rearrangement is observed in about 25% of precursor B-cell ALL, in children diagnosed between the ages of 2 and 10 years (Romana et al., 1995b; Shurtleff et al., 1995; C. McHale is a trainee of the UC Toxic Substances Program. Supported by: National Institutes of Health; Grant numbers: P42ES04705, P30 ES01896, RO1ES09137, RO1CA89032, and K23 80915. *Correspondence to: Martyn T. Smith, School of Public Health, Division of Environmental Health Sciences, 140 Warren Hall, University of California, Berkeley, CA 94720-7360. E-mail: martynts@uclink.berkeley.edu Received 29 July 2002; Accepted 27 November 2002 DOI 10.1002/gcc.10199 2003 Wiley-Liss, Inc. BACKTRACKING TEL-AML1 TRANSLOCATIONS 37 Figure 1. TEL and AML1 long-distance primer design. Primers used for long-distance PCR are represented schematically for the TEL and AML1 genes. Primers sequences are listed in Table 1 (TEL) and Table 2 (AML1). For AML1, the multiplex groups are shown and the three primer members of groups 1 and 10 are shown to illustrate the orientation. TEL intron 5 is about 14.5 kb (GenBank accession nos. U61375 and U63313) and AML1 intron 1 is about 160 kb (GenBank accession no. AP001721.1). Borkhardt et al., 1997). As described above, it has been demonstrated to arise prenatally in several studies based in Europe (Ford et al., 1998; Wiemels et al., 1999a; Maia et al., 2001), with the oldest patient recorded as age 14 years (Wiemels et al., 1999b). The aim of this study was to confirm these findings in a population of patients with cALL in California. MATERIALS AND METHODS Patients Diagnostic samples (n 14) were obtained from a cohort of patients enrolled in the ongoing Northern California Childhood Leukemia Study (NCCLS), previously identified as TEL-AML1-positive by fluorescence in situ hybridization (FISH) (see below). The patients ranged in age from 2.2 to 6.7 years. Corresponding Guthrie cards (neonatal blood spots) for each patient were obtained from a central repository maintained by the Genetic Diseases Branch of the California Department of Health Services. Interphase FISH Detection of t(12;21) (TEL-AML1) The FISH method applied in this study was designed to detect t(12;21) and hyperdiploidy (50 chromosomes) simultaneously. The LSI TELAML1 and alpha-satellite CEP X probes were purchased from Vysis (Downers Grove, IL). The TEL probe begins between exons 35 and extends approximately 350 kb toward the telomere on chromosome 12 and is labeled directly with SpectrumGreen. The AML1 probe labeled directly with SpectrumOrange spans the entire gene of approximately 500 kb. The centromere probe of the X chromosome is labeled with SpectrumAqua. The hybridization procedure was followed according to the company's protocol. FISH signals were viewed with a triple-band filter (Chroma Technology, Brattleboro, VT). The different clone cell types were observed and confirmed by two experienced cytogeneticists (at least 100 cells scored). Preparation of DNA High molecular weight DNA was isolated from the cryopreserved peripheral blood or bone marrow lymphocytes of diagnostic samples, depending on the availability, by use of standard SDS/Proteinase K protocols (Sambrook et al., 1989). Amplification of Genomic Breakpoints by Long-Distance Multiplex PCR A long-distance multiplex protocol was designed to amplify the TEL-AML1 breakpoints from patient DNA samples. Three primers from TEL intron 5 (6B, 9B, 10B) were used in a long-distance PCR reaction in combination with 30 primers (spaced approximately 5 kb apart) from AML1 introns 1 and 2, to cover the breakpoint region in portions amenable to amplification (Fig. 1, Table 1). For each sample, 10 multiplex reactions were set up as an initial screening method, with each PCR reaction containing the three TEL primers in combination with a single multiplex group of three AML1 primers (Fig. 1). Primers were designed to generate products under standardized amplification conditions and to exclude interference with other primers in the multiplex group, such as primer dimer formation. When a positive product was obtained, nine individual reactions were performed by use of each TEL primer in combination with one of the three primers within the AML1 multiplex group to identify which pair of primers had generated the product. PCR products were then purified from agarose gels by use of the QIAquick PCR Purification kit (Qiagen, Chatsworth, CA) and se- 38 Primer name 6B 9B 10B MCHALE ET AL. TABLE 1. TEL and AML1 Primers for Long-Distance PCR TEL/AML1 Sequencea 53 TEL CTCTCATCGGGAAGACCTGGCTTACATG GTCAGTGTGCTTGGAATCATAGGTGC CCAGGTGAGCCGTGGCAACAAC 1a AML1 CCTCCTGTAATGTCCTCCAGGGCA 1 GGACTCTGGCACCAACCAGCTATGG 2a AAGCATGGAGAAGTGACCTCCCAGA 2 AML1 GCAAGCAGTTACTTTCCTGGTCTGCCA 3a TCAGACTGAGGCTGCAGCTCATGGCA 3 GGAAGGGCTGGTAGCTTTGGGTCC 4a AML1 ACGGACTTCAGTTTGCTGAGCCCTGA 4 CTTGGCACCAATGTCCTCTTCACTCC 5a CTCCTGAGTCAGACATTAGCATGGCT 5 AML1 GCAGTAGGAGATGGTGTGTGGAACACC 6a GGGTGGGCTCTGAATCTAATGACTGA 6 CCTTCAGAGGGAGCACAGAATGCC 7a AML1 GGACCTATTCTAGAAGCCTGGTGCCA 7 CGAACACCGTGGAAGCTCTCTGATGT 8a ATACAGGCCTAACTACACCAGAAGGT 8 AML1 GGTTTACTGCCCTGCTGTCCAGAGG 9a CCCTTATGGTGCTGGCTGTGACCGA 9 CAGATGAAGGAGAAGGTTGCTGTCCTAACA 10a AML1 GAGGCCGAGGCAGGTGGATCACT 10 ACCATCCTTTGACCTTGGCCTTGC 11a CAGGTTAGCCCAACGATTGCGCAACA 11 AML1 GAGGCCATGAGGGTGTGAATCAGG 12a AGAGTACATCCAGGGAGGACGCTGA 12 CTACAAGGTGTAGAGGTGGCACAGGGTG 13a AML1 TCTGGTGACCAGTGAGAACCAAGACA 13 CTCTCTCAGTCAGTGTGAAGCAGGAGCC 14a TGCTTCTGAAGGGCAGCCACTCTCCA 14 AML1 CCAAGTGGAGCATCTGAAAATTGCGC 15a GAGCCTGCACTTTCAAGGACAGCCA 15 AACGCCTCGCTCATCTTGCCTGG aSequences for each AML1 multiplex group, illustrated in Figure 1, are listed. Multiplex group N/A M1 M2 M3 M4 M5 M6 M7 M8 M9 M10 quenced by use of forward and reverse PCR primers. Further primers were designed as necessary to "walk in" to the breakpoint sequence. Long-distance PCR was performed by use of eLONGase Enzyme mix (Life Technologies, Gaithersburg, MD) according to the manufacturer's protocol. As recommended, a two-step amplification was performed with an initial denaturation at 94C for 30 sec, followed by 35 cycles of denaturation at 94C for 30 sec and annealing/extension at 68C for 20 min. A MgCl2 concentration of 1.7 mM was used in all reactions. For cases where limited sample material precluded the long-distance PCR approach described, a previously published inverse long-distance protocol was used to obtain patient breakpoints (Wiemels and Greaves, 1999). Guthrie Card Analysis A clonotypic nested PCR assay was designed for each patient breakpoint. Assay specificity was confirmed by testing with patient-specific DNA as well as DNA from several other patients (each with a unique breakpoint). Assay sensitivity was deter- BACKTRACKING TEL-AML1 TRANSLOCATIONS 39 TABLE 2. TEL-AML1 Fusion Sequences for Each Patient* Patient ID P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 Translocation fusion sequence (der12) GTGATTCCTGTGTACAACGTACCTACAAACCATGAAAAAC TGTGAATTCCCAGGCTGCACTGGTAATAGACGCAGGTGGC CTGGAGGGTATAGATGGAAAGTTAGGAGTGGGTTCGTAGA GTTCCGAAAAGGCTGAAAtggcATTGCAATCAGGAAACCA TGGAGGTGAAATTCATTGGGAAGCCAAGTCCACTGAGGAA TGCACCACCAGTGTTGTCTCTCTATCACTGTGAGCACACA TTCCCACTTCATAAGTGAGGCACTGTCTTAAACACACGCA TTTCCTAGGATGCTCATAATGTCAAACTGTATGTTATATA CTACTGTCTGCCAGAGTAATACTAGGAGATTGTATCCGTCC CTGGCCTCAAGTGATCCACCATTTTTAGAGTCTCCTAAGC CCCCTTTCAAATGTGCCAGGCGGAGGCTGAGGCTGGGGCA TTACCAGGTTGGAATGGCTAACATTTTAGAGATTCTGGTT AATTGTTCTCACTCATAGGTcccCAGACTACTTCAGAGTC ATGAAAGAGCTGAGCACAGTGCTGAGTGGGAAGCCATGAT TEL breakpointa,b 31,545a 36,531a 31,722a 38,006a 31,526a 29,685a 2,766b 28,723a 29,024a 3,597b 2,932b 33,363a 32,928a 31,915a AML1 breakpointc 233,742 164,295 200,745 161,105 238,616 195,137 147,578 254,305 229,591 166,809 155,718 243,221 289,466 281,506 *TEL sequences are underlined. Microhomologies (nucleotides common to both TEL and AML1) are noted in bold. Non-template N nucleotides are denoted in lowercase. Locations of breakpoints are referenced to GenBank sequences. TEL intron 5 is covered by two accessions: aGenBank accession U61375 and bGenBank accession U63313. cAML1 introns 1 and 2 are covered by a single accession: GenBank accession AP001721. mined by use of serial dilutions of patient-specific DNA, and in some cases semi-nested reactions showed greater sensitivity. Amplification was performed with Ampdirect buffers (Rockland Immunochemicals, Gilbertsville, PA), according to the manufacturer's protocol. ELONGase enzyme (Life Technologies) was included in the reactions. Before scrutiny of Guthrie cards for clonotypic sequences, each Guthrie card was tested for DNA quality and amplifiability with primers for NAD(P)H:quinone oxidoreductase (NQO1) in a single-round PCR amplification. Primer sequences and PCR conditions were as previously published (Wiemels et al., 1999a). For analysis of Guthrie cards, 1/16th pieces were placed directly in first-round PCR reactions (50 L), or 1/8th pieces were soaked twice in 500 L sterile PCR-grade water and vacuum dried before addition to the PCR reaction. Second-round amplification (25 L) was performed with 1 L from the first-round PCR reactions. PCR conditions included two pre-incubation steps of 80C for 15 min and 94C for 4 min, followed by 40 amplification cycles of 94C for 30 sec, 58C for 1 min, 72C for 1 min, and, finally, a 72C extension step for 7 min. For each patient, at least three quarters of a 1.5-cm spot were analyzed. Serial dilutions of patient diagnostic DNA were analyzed as positive controls were. Negative controls included water and card pieces from a normal non-affected individual. RESULTS Detection and Characterization of TEL-AML1 Fusion Sequences Interphase FISH detected TEL-AML1 fusion gene in 14 patients from the NCCLS, ranging in age from 2.2 to 6.7 years. TEL-AML1 breakpoints from these 14 cALL cases were identified by multiplex long-distance PCR and sequenced. Table 2 shows the fusion sequences and intronic locations of the breakpoints in the TEL and AML1 introns. The distribution of the breakpoints was similar to earlier reports, with an apparent cluster of four breakpoints within a 390-bp region of TEL and with a much wider distribution of breakpoints in the large AML1 intron (Thandla et al., 1999; Wiemels et al., 2000) (Fig. 2). Seven of 14 sequences exhibited microhomologies of between 1 and 3 nucleotides. Two (P4 and P13) of the 14 fusion sequences described had non-template N nucleotides (Table 2), in agreement with sequences reported previously (Thandla et al., 1999), although absence of these nucleotides was reported in another study (Wiemels et al., 2000). Analysis of Guthrie Cards Nested or semi-nested PCR assays were established for each clonotypic sequence and the corresponding Guthrie cards analyzed for the presence of these sequences. Segments were tested in two different ways. Initially for cases P6, P7, and P8, 40 MCHALE ET AL. Figure 2. Distribution of 52 translocation breakpoints along TEL intron 5 and AML1 introns 1 and 2. Breakpoints from individual patients are noted to scale by hash marks. Exons are noted by numbers. Fourteen breakpoints from the current study are noted with asterisks. Additional breakpoints are derived from previous publications [Romana et al. (1999), #34; Wiemels and Greaves (1999), #18; Wiemels et al. (2000), #17; Ford et al. (1998), #3; Maia et al. (2001), #7; Andersen (2001), #33]. TABLE 3. Characteristics and Backtracking Results Among 14 Newly Diagnosed Cases of Leukemia in Children* Born in California Patient ID Age at diagnosis PCR sensitivitya (pg) No. Guthrie segments tested No. Guthrie segments positive for TEL/AML P1 2.9 10 14 (1/16th) P2 3.5 10 14 (1/16th) P3 4.7 100 12 (1/16th) P4 2.2 10 12 (1/16th) P5 3.2 100 12 (1/16th) P6 4.7 100 6 (1/8th) P7 2.8 10 6 (1/8th) P8 4.0 10 6 (1/8th) P9 4.6 10 12 (1/16th) P10 4.3 10 12 (1/16th) P11 2.3 10 12 (1/16th) P12 6.7 10 12 (1/16th) P13 2.5 100 12 (1/16th) P14 2.4 10 14 (1/16th) 3 1 0 0 0 0 2 1 0 2 46 2 0 0 *The number of segments positive for clonotypic TEL-AML1 for each of the 14 cases tested is shown. aThe PCR sensitivity is shown as pg of diagnostic DNA detectable in PCR assay (10 pg is approximately 12 cells, and each Guthrie card segment contains about 4,000 cells; thus sensitivity is in excess of 1 in 1,000). 1/8th segments were soaked twice in distilled water and vacuum dried before addition to the PCR. For the remaining samples, 1/16th segments were added directly to the PCR because of concerns of DNA leaching out during the washing steps. For each sample, the equivalent of at least 12 1/16th segments were tested in two separate assays along with patient-specific DNA positive controls, a control card containing DNA from a normal non-affected individual, and PCR water negative controls. Seven of the 14 cards tested had amplifiable TEL-AML1 fusion DNA in at least one segment (Table 3, Fig. 3). Figure 3 shows the PCR result for each positively backtracked sample. Guthrie spots were tested for each case in two separate assays (Table 3 shows the total number of segments tested per patient). Prenatal TEL-AML1 was detected in P1 in two separate assays, two positive segments of eight tested are shown here, and, in a separate assay (not shown), one of six segments was positive. The ability to detect clonotypic sequences on Guthrie segments requires both a sensitive assay and the presence of the target (if present) at sufficient levels so as to be detectable by the assay. Table 3 shows each backtracking result correlated with the sensitivity of each corresponding PCR assay. For all seven positive cases and three of the negative cases, a sensitivity of 10 pg of diagnostic DNA was attained (Table 3), which is close to detection at the single-cell level (a single lymphocyte contains 6 pg DNA). The remaining four negative cases (P3, P5, P6, P13) had assay sensitivities of 100 pg. Sensitivity of the PCR assay is determined in part by primer design, which in turn is constrained by the need to generate small products to avoid problems with degradation of archival samples. Although sensitivity of the PCR assay may be one factor in the four negative cases with BACKTRACKING TEL-AML1 TRANSLOCATIONS 41 Figure 3. Positive backtracking PCR results. The figure shows the results of the clonotypic PCR assay for each of the seven positively backtracked cases after agarose gel electrophoresis. Standards are shown on the left, ranging from 10 ng to 1 pg of diagnostic DNA. M, molecular weight marker; in most lanes, the 100and 200-bp bands are visible. G, Guthrie segments; C, control cards; B, PCR water blank control. sensitivity of 100 pg, all seven negative cases should be considered uninformative. DISCUSSION The findings reported here confirm two previous European backtracking studies that used Guthrie cards, which concluded that the TEL-AML1 translocation often occurs prenatally and may be an initiating event in cALL (Wiemels et al., 1999a; Maia et al., 2001). One study reported 11 cases, including a pair of twins, of which eight had detectable TEL-AML1 fusion (Wiemels 1999a), whereas the second study reported a set of triplets with identical prenatal TEL-AML1 fusion sequences (Maia et al., 2001). In the present study, clonotypic sequences from 7/14 cases were demonstrated to have an in utero origin, the youngest patient being 2.3 years old and the oldest 6.7 years old. This is the oldest reported cALL case to have been positive by this direct type of assay, although a 14-year latency period was previously reported in a twin case in which the clonotypic sequence was retrospectively detected in a sample obtained 9 years earlier when the first twin was diagnosed with leukemia (Wiemels et al., 1999b). The remaining seven cases, which had negative Guthrie spot PCR results, have to be considered uninformative, given that several factors could have influenced the result, including inadequate PCR sensitivity, subthreshold numbers of pre-leukemic cells in blood at birth than are detectable on the limited Guthrie specimen, and differences in the quality of DNA on the Guthrie cards. In this study, a multiplex long-distance PCR protocol was used to obtain breakpoint sequences. This approach was designed to amplify regions of not more than 10 kb and is a faster, more streamlined approach than the previously used method of inverse PCR (Wiemels and Greaves, 1999) because it allows the approximate location of the breakpoint to be ascertained in one day, whereas the prior inverse PCR approach takes 4 days and results in a higher rate of false positives. It may also be a useful method for minimal residual disease detection because the clonotypic nature of the sequences precludes cross-contamination from other patient samples. However, the inverse PCR approach is the only feasible method when diagnostic material is limiting. The characteristics of the individual breakpoints reported here are similar to previous findings. Wiemels et al. (2000) reported microclustering of 42 MCHALE ET AL. breakpoints in the TEL and AML1 genes based on analysis of 24 sequences. The 14 novel fusion sequences reported here are found distributed across the respective introns in a similar fashion (Fig. 2), and do not further refine microclusters identified previously. Only two of the 14 sequences have non-template N-nucleotides at the chimeric junctions, also observed in three previously reported sequences (Thandla et al., 1999), but absent from a further 20 sequences (Wiemels et al., 2000). The presence of these N-nucleotides alone is not sufficient evidence of V(D)J recombination. The suggested mechanism of translocation generation is error-prone non-homologous end-joining repair of double-stranded breaks in DNA (Chu, 1997). The concordance rate for childhood ALL in identical twins is around 5% (Ford et al., 1998), indicating the requirement for secondary postnatal events. This suggests that considerably more children are likely to acquire a TEL-AML1 fusion in utero than ever have a diagnosis of ALL. Indeed, from 567 newborn cord blood samples screened for t(12;21), about 1% had a TEL-AML1 fusion gene (Mori et al., 2002). One percent represents 100 times the cumulative rate of risk of ALL with TEL-AML1, indicating that the frequency of conversion of the pre-leukemic clone to overt disease is low. As previously discussed, post-natal exposures to chemicals or electromagnetic radiation, additional chromosomal or molecular abnormalities, genetic susceptibility, or infection may all help to promote progression to leukemia (Greaves, 1999, 2002). Secondary changes at the chromosome level include deletion of the non-rearranged TEL allele and trisomy 21. Initial reports showed that the non-translocated allele of TEL was deleted in each of four cases (Golub et al., 1995; Romana et al., 1995a). In a more recent study, microsatellite mapping of the 12p deletions in a pair of monozygotic twins sharing a clonotypic TEL-AML1 sequence demonstrated the TEL deletions to be different and therefore most likely independent events occurring after birth (Maia et al., 2001). Other studies of TEL deletions by FISH in singleton patients with ALL suggest that this genetic abnormality is frequently restricted to a subclone of leukemic cells and is therefore most likely to occur as a secondary event (Raynaud et al., 1996; Romana et al., 1996; Eguchi-Ishimae et al., 1998). Trisomy 21, as a secondary event, has been reported at frequencies of 14.6% (Loncarevic et al., 1999) and 17% (Raynaud et al., 1999). We analyzed the 14 cases described here for secondary changes by interphase FISH (unpublished data). The observed abnormalities included duplication of the fusion gene (n 3), deletion of the non-rearranged TEL allele (n 9), trisomy 21 (n 2), and monosomy X (n 3), in agreement with previous reports (Loncarevic et al., 1999; Raynaud et al., 1999). With the exception of the fusion gene duplication, in which all three cases positively backtracked, other observable secondary features were noted in cases both positive and negative for TEL-AML1 fusion. Interphase FISH also provided additional information about subclonal populations within diagnostic patient bone marrow samples. In the majority of informative cases (three had a single clone with several changes for which a sequence of events could not be discerned), t(12;21) appeared to be the initiating event, followed by the secondary events described above. In conclusion, our findings confirm the in utero origin of at least 50% of cALL cases with TELAML1. We report a faster, more streamlined approach to characterizing the genomic breakpoints. We also confirm previous reports of the likely sequence of secondary events in the development of overt leukemia. ACKNOWLEDGMENTS We thank Dr. James Feusner at Children's Hospital Oakland, Dr. Stacy Month at Kaiser Oakland Hospital, Dr. Gary Dahl at Packard Children's Hospital, Dr. Kenneth Leung at Kaiser San Francisco Hospital, Dr. Vonda Crouse at Children's Hospital of Central California, and their staff for assistance with recruiting patients; and Dr. Fred Lorey, Dr. Peggy Reynolds, and Michael Layefsky at the California Department of Health Services for access to Guthrie cards. This work was funded by National Institutes of Health grants P42ES04705 (to M.T.S. and P.A.B.), P30 ES01896 (to M.T.S.), RO1ES09137 (to P.A.B.), RO1CA89032 (to J.L.W.), and K23-80915 (to M.L.L.). REFERENCES Andersen MT, Nordentoft I, Hjalgrim LL, Christiansen CL, Jakobsen VD, Hjalgrim H, Pallisgaard N, Madsen HO, Christiansen M, Ryder LP, Clausen N, Hokland P, Schmiegelow K, Melbye M, Jorgensen P. 2001. Characterization of t(12;21) breakpoint junctions in acute lymphoblastic leukemia. Leukemia 15:858 859. Borkhardt A, Cazzaniga G, Viehmann S, Valsecchi MG, Ludwig WD, Burci L, Mangioni S, Schrappe M, Riehm H, Lampert F, Basso G, Masera G, Harbott J, Biondi A. 1997. Incidence and clinical relevance of TEL/AML1 fusion gene in children with acute lymphoblastic leukemia enrolled in the German and Italian Multicenter Therapy Trials. Associazione Italiana Ematologia Oncologia Pediatrica and the Berlin-Frankfurt-Munster Study Group. Blood 90:571577. BACKTRACKING TEL-AML1 TRANSLOCATIONS 43 Chu G. 1997. Double strand break repair. J Biol Chem 272:24097 24100. Eguchi-Ishimae M, Eguchi M, Tanaka K, Hamamoto K, Ohki M, Ueda K, Kamada N. 1998. Fluorescence in situ hybridization analysis of 12;21 translocation in Japanese childhood acute lymphoblastic leukemia. Jpn J Cancer Res 89:783788. Fasching K, Panzer S, Haas OA, Marschalek R, Gadner H, PanzerGrumayer ER. 2000. Presence of clone-specific antigen receptor gene rearrangements at birth indicates an in utero origin of diverse types of early childhood acute lymphoblastic leukemia. Blood 95:27222724. Ford AM, Ridge SA, Cabrera ME, Mahmoud H, Steel CM, Chan LC, Greaves M. 1993. In utero rearrangements in the trithoraxrelated oncogene in infant leukaemias. Nature 363:358 360. Ford AM, Bennett CA, Price CM, Bruin MC, Van Wering ER, Greaves M. 1998. Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia. Proc Natl Acad Sci USA 95:4584 4588. Gale KB, Ford AM, Repp R, Borkhardt A, Keller C, Eden OB, Greaves MF. 1997. Backtracking leukemia to birth: identification of clonotypic gene fusion sequences in neonatal blood spots. Proc Natl Acad Sci USA 94:13950 13954. Gill Super HJ, Rothberg PG, Kobayashi H, Freeman AI, Diaz MO, Rowley JD. 1994. Clonal, nonconstitutional rearrangements of the MLL gene in infant twins with acute lymphoblastic leukemia: in utero chromosome rearrangement of 11q23. Blood 83:641 644. Golub TR, Barker GF, Bohlander SK, Hiebert SW, Ward DC, Brayward P, Morgan E, Raimondi SC, Rowley JD, Gilliland DG. 1995. Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proc Natl Acad Sci USA 92:4917 4921. Greaves M. 1999. Molecular genetics, natural history and the demise of childhood leukemia. Eur J Cancer 35:19411953. Greaves M. 2002. Science, medicine and the future: childhood leukemia. Br Med J 234:283287. Loncarevic IF, Roitzheim B, Ritterbach J, Viehmann S, Borkhardt A, Lampert F, Harbott J. 1999. Trisomy 21 is a recurrent secondary aberration in childhood acute lymphoblastic leukemia with TEL/AML1 gene fusion. Genes Chromosomes Cancer 24:272 277. Maia AT, Ford AM, Jalali GR, Harrison CJ, Taylor GM, Eden OB, Greaves MF. 2001. Molecular tracking of leukemogenesis in a triplet pregnancy. Blood 98:478 482. Mori H, Colman SM, Xiao Z, Ford AM, Healy LE, Donaldson C, Hows JM, Navarrete C, Greaves M. 2002. Chromosome translocations and covert leukemic clones are generated during normal fetal development. Proc Natl Acad Sci USA 99:8242 8247. Raynaud S, Cave H, Baens M, Bastard C, Cacheux V, Grosgeorge J, Guidal-Giroux C, Guo C, Vilmer E, Marynen P, Grandchamp B. 1996. The 12;21 translocation involving TEL and deletion of the other TEL allele: two frequently associated alterations found in childhood acute lymphoblastic leukemia. Blood 87:28912899. Raynaud SD, Dastugue N, Zoccola D, Shurtleff SA, Mathew S, Raimondi SC. 1999. Cytogenetic abnormalities associated with the t(12;21): a collaborative study of 169 children with t(12;21)positive acute lymphoblastic leukemia. Leukemia 13:13251330. Romana SP, Mauchauffe M, Le Coniat M, Chumakov I, Le Paslier D, Berger R, Bernard OA. 1995a. The t(12;21) of acute lymphoblastic leukemia results in a TEL-AML1 gene fusion. Blood 85:36623670. Romana SP, Poirel H, Leconiat M, Flexor MA, Mauchauffe M, Jonveaux P, Macintyre EA, Berger R, Bernard OA. 1995b. High frequency of t(12;21) in childhood B-lineage acute lymphoblastic leukemia. Blood 86:4263 4269. Romana SP, Le Coniat M, Poirel H, Marynen P, Bernard OA, Berger R. 1996. Deletion of the short arm of chromosome 12 is a secondary event in acute lymphoblastic leukemia with t(12;21). Leukemia 10:167170. Romana SP, Poirel H, Della Valle V, Mauchauffe M, Busson-Le Coniat M, Berger R, Bernard OA. 1999. Molecular analysis of chromosomal breakpoints in three examples of chromosomal translocation involving the TEL gene. Leukemia 13:1754 1759. Sambrook J, Maniatis T, Fritsch EF. 1989. Molecular cloning, a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Shurtleff SA, Buijs A, Behm FG, Rubnitz JE, Raimondi SC, Hancock ML, Chan C-F, Pui C-H, Grosveld G, Downing JR. 1995. TEL/AML1 fusion resulting from a cryptic t(12;21) is the most common genetic lesion in pediatric ALL and defines a subgroup of patients with an excellent prognosis. Leukemia 9:19851989. Taub JW, Konrad MA, Ge Y, Naber JM, Scott JS, Matherly LH, Ravindranath Y. 2002. High frequency of leukemic clones in newborn screening blood samples of children with B-precursor acute lymphoblastic leukemia. Blood 99:29922996. Thandla SP, Ploski JE, Raza-Egilmez SZ, Chhalliyil PP, Block AW, de Jong PJ, Aplan PD. 1999. ETV6-AML1 translocation breakpoints cluster near a purine/pyrimidine repeat region in the ETV6 gene. Blood 93:293299. Wiemels JL, Greaves M. 1999. Structure and possible mechanisms of TEL-AML1 gene fusions in childhood acute lymphoblastic leukemia. Cancer Res 59:4075 4082. Wiemels JL, Cazzaniga G, Daniotti M, Eden OB, Addison GM, Masera G, Saha V, Biondi A, Greaves MF. 1999a. Prenatal origin of acute lymphoblastic leukemia in children. Lancet 354:1499 1503. Wiemels JL, Ford AM, Van Wering ER, Postma A, Greaves M. 1999b. Protracted and variable latency of acute lymphoblastic leukemia after TEL-AML1 gene fusion in utero. Blood 94:1057 1062. Wiemels JL, Alexander FE, Cazzaniga G, Biondi A, Mayer SP, Greaves M. 2000. Microclustering of TEL-AML1 translocation breakpoints in childhood acute lymphoblastic leukemia. Genes Chromosomes Cancer 29:219 228. Yagi T, Hibi S, Tabata Y, Kuriyama K, Teramura T, Hashida T, Shimizu Y, Takimoto T, Todo S, Sawada T, Imashuku S. 2000. Detection of clonotypic IGH and TCR rearrangements in the neonatal blood spots of infants and children with B-cell precursor acute lymphoblastic leukemia. Blood 96:264 268.