Document oeZwboM3vpBzODn6qp24VMK8g

Investigative Urology Aberrant Promoter Methylation of DLEC1, a Critical 3p22 Tumor Suppressor for Renal Cell Carcinoma, is Associated With More Advanced Tumor Stage Qian Zhang,* Jianming Ying,* Jisheng Li, Yichao Fan, Fan Fong Poon, Ka Man Ng, Qian Tao and Jie Jin From the Department of Urology, Peking University First Hospital and Institute of Urology, Peking University (QZ, JJ), National Research Center for Genitourinary Oncology (QZ, JY, QT, JJ), Joint Center for Cancer Epigenetics, China (QZ, JY, QT, JJ) and Department of Pathology, Cancer Hospital, Peking Union Medical College and Chinese Academy of Medical Sciences (JY), Beijing and Cancer Epigenetics Laboratory, State Key Laboratory in Oncology in South China, Sir Y. K. Pao Center for Cancer, Department of Clinical Oncology, Hong Kong Cancer Institute and Li Ka Shing Institute of Health Sciences, Chinese University of Hong Kong (JL, YF, FFP, KMN, QT), Hong Kong Special Administrative Region, People's Republic of China Abbreviations Purpose: Identifying tumor suppressor genes silenced by promoter CpG methylation uncovers mechanisms of tumorigenesis and identifies new epigenetic biomarkers for early cancer detection. DLEC1 is located at 3p22.3, a critical tumor suppressor gene locus for renal cell carcinoma. We explored its epigenetic alteration in renal cell carcinoma and possible clinicopathological association. Materials and Methods: We examined DLEC1 expression and methylation by semiquantitative reverse transcriptase and methylation specific polymerase chain reaction in 9 renal cell carcinoma cell lines and 81 primary tumors. We also analyzed the relationship between DLEC1 methylation and clinicopathological features in patients with renal cell carcinoma. We assessed DLEC1 inhibition of renal cell carcinoma cell growth by colony formation assay. Results: DLEC1 methylation and down-regulation were detected in all renal cell carcinoma cell lines. Treatment with 5-aza-2=-deoxycytidine (Sigma) and/or trichostatin A (Cayman Chemical, Ann Arbor, Michigan) reversed methylation and Acronyms AJCC American Joint Committee on Cancer Aza 5-aza-2=-deoxycytidine BGS bisulfite genomic sequencing CDH1 cadherin-1 DLEC1 deleted in lung and esophageal cancer GAPDH glyceraldehyde-3dehydrogenase LOH loss of heterozygosity MSP methylation specific PCR PCR polymerase chain reaction and restored DLEC1 expression, indicating that methylation directly mediates RASSF1A Ras association its silencing. Aberrant methylation was further detected in 25 of 81 primary family 1A tumors (31%) but only 1 of 53 nonmalignant renal tissues (2%) showed methyl- RCC renal cell carcinoma ation. DLEC1 methylation status was significantly associated with TNM classi- RT reverse transcriptase fication and grade in patients with renal cell carcinoma (chi-square test p 0.01 TSA trichostatin A and 0.04, respectively). DLEC1 ectopic expression in silenced renal cell carci- TSG tumor suppressor gene noma cells resulted in substantial tumor cell clonogenicity inhibition. Conclusions: To our knowledge we report for the first time that DLEC1 is often VHL von Hippel-Lindau down-regulated by CpG methylation and shows tumor inhibitory function in renal cell carcinoma cells, indicating its role as a tumor suppressor. DLEC1 tumor specific methylation may serve as a biomarker for early detection and prognosis prediction of this tumor. Submitted for publication December 2, 2008. Study received institutional review board approval. Supported by NSFC Grant 30928012 and The Chinese University of Hong Kong. Key Words: kidney; carcinoma, renal cell; DLEC1 (deleted in lung cancer) protein, human; methylation; genes, tumor suppressor * Equal study contribution. Correspondence: Room 315, Cancer Center, PWH, Department of Clinical Oncology, Chinese University of Hong Kong, Shatin, Hong Kong, China (telephone: 852-2632-1340; FAX: 852-2648- 8842; e-mail: qtao@clo.cuhk.edu.hk). RENAL cell carcinoma accounts for 3% of all adult malignancies and is the most common primary tumor arising from adult kidneys. Early stage RCC is usually asymptomatic but a significant percent of patients with RCC Correspondence: Department of Urology, Peking University First Hospital, Beijing, China (telephone: (86) 10-66551122-2627; FAX: (86) 1066175710; e-mail: jinjie@vip.163.com). 0022-5347/10/1842-0731/0 THE JOURNAL OF UROLOGY 2010 by AMERICAN UROLOGICAL ASSOCIATION EDUCATION AND RESEARCH, INC. Vol. 184, 731-737, August 2010 Printed in U.S.A. DOI:10.1016/j.juro.2010.03.108 www.jurology.com 731 732 DLEC1 ABERRANT PROMOTER METHYLATION AND ADVANCED TUMOR STAGE present with metastatic disease and experience low treatment efficacy. As reported previously, approximately 33% of patients with RCC have metastatic disease at presentation while metastasis eventually develops in 40% who undergo surgical resection.1 Thus, novel, specific biomarkers are urgently needed for early detection of this tumor. Elucidation of the molecular mechanisms underlying RCC development leads to the identification of promising targets for tumor early diagnosis and the further development of targeted therapy based on the biological pathways that are deregulated in an individual. Like other solid tumors, RCC arises by the accumulation of multiple genetic and epigenetic alterations.2 Alterations at 3p, especially the 3p22-11 region, are among the most commonly detected tumor associated genetic changes in RCC cases.3 Mutations in the VHL gene, often with LOH at 3p26-25, are the most common genetic events described in this cancer.3 The LOH of fragile histidine triad, located at 3p14.2, was reported to be an early event in RCC development and a characteristic of all RCC types.3 As an alternative to genetic changes, DNA methylation of CpG rich promoter regions is now recognized as a major epigenetic mechanism to inactivate TSGs in cancer cases, which leads to transcription repressor binding, compressed chromatin and transcription silencing.4 Tumor specific CpG methylation can provide clues to identify novel TSGs and biomarkers for early tumor detection and prognosis assessment. A growing number of aberrantly methylated TSGs have been reported in RCC, including VHL; RASSF1A; p16; adenomatous polyposis coli; glutathione-S-transferase P; death associated protein kinase; CDH1; differentially expressed in adenocarcinoma of the lung; -catenin; serine peptidase inhibitor, Kunitz type, 2; and homeobox B13.510 Our group also recently reported frequent deleted in liver cancer 1 methylation in RCC cases.11 However, the rate of aberrant methylation of most TSGs is relatively low for RCC at about 10% to 30%. Thus, more studies are needed for RCC epigenetic alterations. To identify critical TSGs and specific biomarkers for RCC, we studied 3p22-21.3, a chromosomal region with frequent LOH in various cancer types, including RCC.12 Several candidate TSGs located at this locus, such as RASSF1A; sema domain, Ig domain (Ig), short basic domain, secreted, (semaphorin) 3B; human ortholog of the yeast YA22; phospholipase C, 1; and BLU, are inactivated by DNA methylation in tumors.13 We recently identified DLEC1, located at the AP20 subregion, as a hypermethylated target with tumor suppressor functions in multiple tumors, including hepatocellular, colorectal, gastric, esophageal and nasopharyngeal carcinoma.14,15 In the current series we explored its epigenetic alteration in RCC, and the relationship between DLEC1 methylation and clinicopathological features in patients with RCC, which to our knowledge have not been previously studied. We also assessed its ability to inhibit RCC cell clonogenicity. MATERIALS AND METHODS Patients and Tissue Samples All human primary RCCs (81 cases) and adjacent nonmalignant renal tissue (53) were obtained from the urology department, Peking University First Hospital, Beijing, People's Republic of China, from January 2005 to March 2006. Patients provided consent according to university policy. Table 1 lists patient clinicopathological features. The male-to-female ratio was 2.38:1 (57:24). Mean age overall was 52.0 years (range 21 to 76), and in patients with methylated and unmethylated DLEC1 promoter it was 56.9 and 53.2 years, respectively (p 0.34). All cases were collected from primary surgical resection with no prior history of RCC and adjuvant therapy. Specimens were snap frozen in liquid nitrogen and subsequently stored at 80C. Pathological diagnosis was done and confirmed at the pathology department, Institute of Urology, Peking University First Hospital. Tumors were histopathologically classified by 2002 AJCC TNM stage.16 Cell Lines and Drug Treatment The RCC cell lines 786-O, CaKi-2, ACHN, A498, CaKi, HH050, HH244, RCC52 and RCC98, the human normal embryonic kidney cell line HEK293 transformed with sheared human adenovirus type 5 (HAd5) DNA and the nontumorigenic human kidney epidermal keratinocyte cell line RHEK-1 immortalized by Adl2-SV40 virus as controls were routinely maintained in RPMI1640 or Dulbecco's modified Eagle's medium with 10% fetal bovine Table 1. Clinicopathological features in patients with RCC and DLEC1 methylation status Clinicopathological No. Methylated No. Unmethylated Features (%) (%) p Value Overall Gender: M F Side: Rt Lt TNM classification: pT1a pT1b pT2 pT3 Nuclear grade: G1 G2 G3 25 (30.9) 21 (36.8) 4 (16.7) 10 (28.6) 15 (32.6) 7 (17.5) 5 (33.3) 6 (42.9) 7 (58.3) 3 (15.0) 13 (29.5) 9 (52.9) 56 (69.1) 36 (63.2) 20 (83.3) 25 (71.4) 31 (67.4) 33 (82.5) 10 (66.7) 8 (57.1) 5 (41.7) 17 (85.0) 31 (70.5) 8 (47.1) Not significant (Student's t test) Not significant (Fisher's exact test) 0.113 Not significant (Fisher's exact test) 0.180 0.01 (chi-square test) 0.04 (chi-square test) DLEC1 ABERRANT PROMOTER METHYLATION AND ADVANCED TUMOR STAGE 733 serum, 100 U/ml penicillin G and 100 mg/ml streptomycin. Cells were incubated at 37C in a humidified atmosphere with 5% CO2. Cell lines were treated with 10 M Aza with or without 100 nM TSA, as described previously.17 DNA and RNA Extraction DNA and RNA extraction from cell lines was done as described previously,11,17 using TRI Reagent. For DNA extraction from tissue the tumor and normal kidney tissues were homogenized in the presence of liquid nitrogen and incubated in 10 mM tris HCl (pH 8.0), 50 mM ethylenediaminetetraacetic acid, 10 mM NaCl, 2% N-lauryl sarcosyl and 200 g/ml proteinase K for 20 hours at 55C, followed by phenol-chloroform extraction and ethanol precipitation.11 Semiquantitative RT-PCR DLEC1 expression was determined by semiquantitative RT-PCR using the RNA PCR kit (Applied Biosystems) and Go Taq. Table 2 lists primer sequences and cycling parameters. MSP and BGS DNA bisulfite treatment, MSP and BGS were done according to our previous reports.11,18 Table 2 lists MSP and BGS primers, and PCR conditions. MSP primers were tested previously for not amplifying any unbisulfited DNA and MSP products of several primary tumors were confirmed by direct sequencing with BigDye v3.1, indicating that our MSP system was specific. Amplified BGS products were TA cloned and 5 to 10 colonies were randomly chosen and sequenced. Colony Formation Analysis Cells (1.5 105 per well) were plated in a 12-well plate and transfected with expression plasmid pcDNA3.1DLEC1 or the empty vector pcDNA3.1 (0.8 g each) using FuGene 6. At 48 hours after transfection cells were collected and replated in a 6-well plate and selected for 2 weeks with G418 (0.4 mg/ml). Surviving colonies (50 or greater cells per colony) were counted after staining with gentian violet. Total RNA from transfected cells was extracted, treated with TURBO DNaseTM and analyzed by RT-PCR to confirm DLEC1 ectopic expression. All experiments were done 3 times in triplicate wells. Table 2. Primers PCR (primer) Sequence Product No. Annealing Size PCR Temperature (bp) Cycles (C) RT-PCR DLEC1A DLEC1B MSP: DLEC1m1 DLEC1m2 DLEC1u1 DLEC1u2 BGS: DLEC1BGS56 DLEC1BGS4 ttcctccctcgcctactc aaactcatccagccgctg gtttcgtagttcggtttcgtc cgaaatatcttaaatacgcaacg tagttttgtagtttggttttgtt acaaaatatcttaaatacacaaca gggtttagtagttttagttag caactacaaccccaaatcctaa 309 107 110 429 35 40 40 40 55 58 55 58 a DLEC1 Exon 1 MSP BGS region (429-bp) b RCC Normal Kidney A498 ACHN CaKi-2 786-O RCC52 RCC98 HH244 HH050 CaKi HEK293 RHEK1 Adult Fetal Markers A+T A+T A+T Aza A+T Aza A+T RT- DLEC1 PCR GAPDH M MSP U c 786-O HH244 A498 ACHN Caki-2 DLEC1 GAPDH M MSP U Figure 1. DLEC1 down-regulation by promoter methylation in RCC cell lines. a, DLEC1 promoter CpG island, with exon 1, CpG sites (vertical lines), MSP and BGS regions. Arrow indicates transcription start site. b, DLEC1 expression and methylation in RCC, HEK293 and RHEK-1 cell lines on RT-PCR and MSP with GAPDH as control. DLEC1 was readily detected in normal fetal and adult renal tissues. M, methylated. U, unmethylated. c, pharmacological demethylation using Aza with or without TSA induced DLEC1 expression in methylated and silenced cell lines. AT, Aza and TSA. Statistical Analysis Experimental differences were tested for statistical significance using the 2-tailed t-test, Fisher exact test or chisquare test with p 0.05 considered significant. RESULTS DLEC1 in RCC Cell Lines Down-regulation due to promoter CpG methylation. We first examined the DLEC1 expression in 9 RCC cell lines by semiquantitative RT-PCR. Results showed that DLEC1 was silenced or down-regulated in all cell lines compared to its expression in normal fetal and adult renal tissues (fig. 1, b). HEK293 cells also showed high DLEC1 expression while the immortalized RHEK-1 cell line had only weak expression. The region spanning the putative promoter and exon 1 of DLEC1 is a typical CpG island and, thus, susceptible to epigenetic silencing (fig. 1, a). We designed MSP and BGS primers to analyze its methylation status. On MSP DLEC1 methylation was detected in all RCC cell lines and RHEK-1 but only weak methylation was detected in HEK293 (fig. 1, b). Further detailed methylation analysis using BGS in 3 RCC cell lines confirmed MSP results with high density of methylated CpG sites detected in all (fig. 2). Results showed that DLEC1 down-regula- 734 DLEC1 ABERRANT PROMOTER METHYLATION AND ADVANCED TUMOR STAGE Figure 2. BGS high resolution mapping of methylation status of each CpG site (ovals) in DLEC1 promoter. Rows represent individual allele of DLEC1 promoter analyzed. Arrows indicate MSP primer sites. Filled ovals indicate methylated. Open ovals indicate unmethylated. AT, Aza and TSA. tion is common in RCC cell lines and closely correlates with its promoter methylation. Expression restoration after demethylation agent treatment. To determine whether methylation directly mediates DLEC1 silencing the 5 cell lines 786-O, A498, ACHN, HH244 and CaKi-2 were treated with the DNA methyltransferase inhibitor Aza with or without the histone deacetylase inhibitor TSA. After treatment DLEC1 expression was significantly increased in these cell lines along with an increase in unmethylated promoter alleles and a decrease in methylated alleles (fig. 1, c). Further detailed BGS methylation analysis for 786-O before and after Aza treatment confirmed its demethylation (fig. 2). Results showed that CpG methylation of the DLEC1 promoter directly led to its silencing in RCC. Ectopic Expression of DLEC1 Inhibited Renal Tumor Cell Clonogenicity To examine the potential tumor suppressor functions of DLEC1 in RCC cells DLEC1 expressing construct was transiently transfected into 786-O and HH244 cells with methylated and silenced DLEC1, and assessed with anchorage dependent colony formation assays. After selecting transfected cells with G418 for 2 weeks the number of colonies formed in DLEC1 transfectants was significantly less than that in empty vector transfectants, ie down to 21% in 786-O and 16% in HH244, indicating that DLEC1 strongly suppressed RCC cell growth (fig. 3). DLEC1 Methylation and RCC Clinicopathological Features We further analyzed 81 primary RCC samples and 53 tumor adjacent, nonmalignant renal tissues from the same patients for DLEC1 methylation status and clinicopathological features (table 1 and fig. 4). Of 81 tumor samples 25 (31%) showed methylation while only 1 of 53 normal renal tissues (2%) had methylation. Unmethylated bands were detected in all RCC and all nonmalignant samples. Figure 4 shows representative MSP results, which were confirmed by direct sequencing of methylation specific and unmethylation specific bands in some cases (data not shown). Further detailed methylation analysis using BGS in 6 RCC and 2 normal tissues confirmed MSP results. In RCC-C22, C26, C81, C49 and C57, in ac HH244 HH244 786-O Relative colony formation ability (%) Markers pcDNA3.1 DLEC1 pcDNA3.1 DLEC1 pcDNA3.1 b 120 100 80 60 40 20 0 DLEC1 No plasmid DLEC1 GAPDH pcDNA3.1 DLEC1 HH244 786-O Figure 3. Ectopic DLEC1 expression suppressed RCC cell clonogenicity. a, representative inhibition of colony formation in monolayer culture by DLEC1 in HH244 cells transfected with pcDNA3.1-DLEC1 or pcDNA3.1 and selected with G418. b, colony number quantitative analysis. Number of G418 resistant colonies in vector transfected cells was set to 100%. Values represent mean SD of 3 independent experiments. c, DLEC1 ectopic expression was confirmed by 32-cycle RT-PCR. DLEC1 ABERRANT PROMOTER METHYLATION AND ADVANCED TUMOR STAGE 735 Figure 4. Representative MSP results. a, DLEC1 methylation in RCC. M, methylated promoter. U, unmethylated promoter. b, paired RCC (C) and matched normal renal tissue (N) samples. which DLEC1 methylation was detected by MSP (figs. 4 and 5), densely methylated alleles were detected by BGS. In contrast, few methylated CpG sites were found in RCC-C17 or in normal tissues N49 and N57, which had no methylated band on MSP (figs. 4 and 5). To evaluate the relationship of DLEC1 methylation with clinicopathological features in patients with RCC, 81 tumors were divided into 2 subgroups by DLEC1 methylation status. There was no signif- icant association of DLEC1 methylation with gender or age (table 1). We then analyzed the relationship of stages pT1, T2 and T3 with DLEC1 methylation. According to the AJCC 2002 update pT1 stage can be further divided into T1a (tumors 4 cm or less) and T1b (tumors greater than 4 to 7 cm or less). DLEC1 methylation was significantly more common in more advanced stage tumors (pT1a vs pT1b, pT2 and pT3, p 0.01). We also discovered a positive correlation between DLEC1 methylation and nuclear grade on statistical analysis (p 0.04). DISCUSSION We examined DLEC1 methylation status in RCC cell lines and tumor tissues. To our knowledge this represents the first study of DLEC1 epigenetic alteration in RCC and its relationship with clinicopathological features. DLEC1 methylation and down-regulation were detected in all 9 RCC cell lines and DLEC1 was methylated in 31% of primary RCCs. The higher methylation rate in cell lines than in primary tumors indicates that some cell lines may have acquired DLEC1 methylation during the establishment or maintenance process. DLEC1 methylation also significantly correlated with TNM classification and grade in patients Figure 5. BGS high resolution mapping of DLEC1 methylation in RCC and paired nontumor samples. Arrows indicate MSP primer sites. Ovals indicate CpG site. Filled ovals indicate methylated. Open ovals indicate unmethylated. Rows indicate individual alleles analyzed. 736 DLEC1 ABERRANT PROMOTER METHYLATION AND ADVANCED TUMOR STAGE with RCC but further, larger scale studies are needed to confirm these findings. The incidence of DLEC1 methylation in RCC was similar to that in colon (29%) and gastric (34%)15 cancers but less than in ovarian (54%)19 and nasopharyngeal (71%) cancers.20 However, DLEC1 is still more commonly methylated than other TSGs, including VHL, p16, adenomatous polyposis coli, glutathione-S-transferase P, alternative reading frame, death associated protein kinase, checkpoint with forkhead and ring finger domains, MLH1 and CDH1, which are generally methylated in less than 30% of RCCs.9,10,21 DNA methylation is a key regulatory factor of gene transcription and genomic stability. DNA methylation alteration is one of the most common epigenetic changes to silence TSGs in cancer,4 al- though it is less often observed in RCC. For example, RASSAF1 is methylated in 27% to 56%,21 tissue inhibitor of metalloproteinase-3 is methylated in 58% to 78%,21 homeobox B13 is methylated in 73%9 and CTNNG/c-catenin is methylated in 83%8 of RCCs. Recently we reported deleted in liver cancer 1 methylation in 35% of RCCs.11 Epigenetic silencing of these TSGs leads to aberrant cell regulations and contributes to RCC pathogenesis. DLEC1, located in 3p22.3, contains 37 exons, spans about 59 kb and encodes a 1,755 amino acid protein. DLEC1 was first identified as a candidate TSG involved in lung and esophageal cancers.22 Later it was also reported to be commonly down- regulated by epigenetic alteration in ovarian cancer19 and nasopharyngeal carcinoma.20 Recently our group also reported methylation associated DLEC1 silencing in hepatocellular, colon and gastric cancers.14,15 These findings suggest that DLEC1 is a putative TSG for multiple cancers. In this study DLEC1 functional significance was further explored by examining the inhibitory effect of DLEC1 expres- sion in renal tumor cells. Introducing DLEC1 in silenced cell lines 786-O and HH244 significantly suppressed growth on colony formation assay. A similar tumor suppressive property of DLEC1 was observed in esophageal, lung, colon, gastric, liver, nasopharyngeal and ovarian tumor cells.14,15,19,20,22 However, to our knowledge the molecular mechanism underlying this tumor suppressive function of DLEC1 remains unknown. The predicted amino acid sequence of DLEC1 has no significant homology to any known protein or domain while 27 potential CK2 phosphorylation sites are present in DLEC1.22 CK2 is required at multiple transitions of the cell cycle, including G0/G1, G1/S and G2/M,14 indicating that DLEC1 may be a CK2 target involved in cell cycle arrest. Our recent study also proved that DLEC1 induced G1 cell cycle arrest in hepatocellular carcinoma cells.14 TNM and nuclear grades are commonly used for prognostic prediction in patients with RCC. RCC staging has evolved from the Robson classification to the TNM system, as developed by UICC and AJCC. The most recent revision of the TNM system for RCC, introduced in 2002, further subdivided organ confined tumors, reclassified tumors with venous involvement and clarified the staging of tumors invading perisinus fat.16 Multiple studies suggest that these revisions have substantially improved prognostic prediction in patients with RCC.23 Tumor specific TSG promoter methylation can also serve as a tumor biomarker for early diagnosis and prognostication.24 Our statistical analysis of clinicopathological features in patients with RCC showed a positive correlation between DLEC1 methylation and pTNM stage or nuclear grade. Similar findings were noted for hepatocellular carcinoma.14 In conclusion, our results suggest that DLEC1 inactivation may increase the malignant potential of renal cancer, and detecting DLEC1 methylation could provide prognostic information on this disease, especially when TSG methylation can be detected in serum and urine samples in patients with RCC, such as RASSF1A, tissue inhibitor of metalloproteinase-3 and CDH1 methylation.25 ACKNOWLEDGMENTS Cell lines were provided by Drs. Shuen-Kuei Liao, Chang Gung University, Taiwan, Republic of China, and Johng S. Rhim, Center for Prostate Disease Research, Uniformed Services University of the Health Sciences, Bethesda, Maryland, or obtained from ATCC. Ada Ho Yan Wong provided technical support. REFERENCES 1. McLaughlin JK, Lipworth L and Tarone RE: Epidemiologic aspects of renal cell carcinoma. Semin Oncol 2006; 33: 527. 2. Knudson AG: Two genetic hits (more or less) to cancer. Nat Rev Cancer 2001; 1: 157. 3. Sukosd F, Kuroda N, Beothe T et al: Deletion of chromosome 3p14.2-p25 involving the VHL and FHIT genes in conventional renal cell carcinoma. Cancer Res 2003; 63: 455. 4. Jones PA and Baylin SB: The fundamental role of epigenetic events in cancer. Nat Rev Genet 2002; 3: 415. 5. Yamada D, Kikuchi S, Williams YN et al: Promoter hypermethylation of the potential tumor suppressor DAL-1/4.1B gene in renal clear cell carcinoma. Int J Cancer 2006; 118: 916. 6. Morris MR, Gentle D, Abdulrahman M et al: Tumor suppressor activity and epigenetic inactivation of hepatocyte growth factor activator inhibitor type 2/SPINT2 in papillary and clear cell renal cell carcinoma. Cancer Res 2005; 65: 4598. DLEC1 ABERRANT PROMOTER METHYLATION AND ADVANCED TUMOR STAGE 737 7. Dreijerink K, Braga E, Kuzmin I et al: The candidate tumor suppressor gene, RASSF1A, from human chromosome 3p21 3 is involved in kidney tumorigenesis Proc Natl Acad Sci U S A 2001; 98: 7504. 8. Breault JE, Shiina H, Igawa M et al: Methylation of the gamma-catenin gene is associated with poor prognosis of renal cell carcinoma. Clin Cancer Res 2005; 11: 557. 9. Okuda H, Toyota M, Ishida W et al: Epigenetic inactivation of the candidate tumor suppressor gene HOXB13 in human renal cell carcinoma. Oncogene 2006; 25: 1733. 10. Sanz-Casla MT, Maestro ML, del BV et al: Loss of heterozygosity and methylation of p16 in renal cell carcinoma. Urol Res 2003; 31: 159. 11. Zhang Q, Ying J, Zhang K et al: Aberrant methylation of the 8p22 tumor suppressor gene DLC1 in renal cell carcinoma. Cancer Lett 2007; 249: 220. 12. Imreh S, Klein G and Zabarovsky ER: Search for unknown tumor-antagonizing genes. Genes Chromosomes Cancer 2003; 38: 307. 13. Ito M, Ito G, Kondo M et al: Frequent inactivation of RASSF1A, BLU, and SEMA3B on 3p21 3 by promoter hypermethylation and allele loss in non- small cell lung cancer. Cancer Lett 2005; 225: 131. 14. Qiu GH, Salto-Tellez M, Ross JA et al: The tumor suppressor gene DLEC1 is frequently silenced by DNA methylation in hepatocellular carcinoma and induces G1 arrest in cell cycle. J Hepatol 2008; 48: 433. 15. Ying J, Poon FF, Yu J et al: DLEC1 is a functional 3p22.3 tumour suppressor silenced by promoter CpG methylation in colon and gastric cancers. Br J Cancer 2009; 100: 663. 16. Greene FL: American Joint Committee on Cancer Staging Manual. New York: Springer-Verlag 2002. 17. Ying J, Srivastava G, Hsieh WS et al: The stressresponsive gene GADD45G is a functional tumor suppressor, with its response to environmental stresses frequently disrupted epigenetically in multiple tumors. Clin Cancer Res 2005; 11: 6442. 18. Tao Q, Huang H, Geiman TM et al: Defective de novo methylation of viral and cellular DNA sequences in ICF syndrome cells. Hum Mol Genet 2002; 11: 2091. 19. Kwong J, Lee JY, Wong KK et al: Candidate tumor-suppressor gene DLEC1 is frequently downregulated by promoter hypermethylation and histone hypoacetylation in human epithelial ovarian cancer. Neoplasia 2006; 8: 268. 20. Kwong J, Chow LS, Wong AY et al: Epigenetic inactivation of the deleted in lung and esophageal cancer 1 gene in nasopharyngeal carcinoma. Genes Chromosomes Cancer 2007; 46: 171. 21. Dulaimi E, Ibanez dC I Uzzo RG et al: Promoter hypermethylation profile of kidney cancer. Clin Cancer Res 2004; 10: 3972. 22. Daigo Y, Nishiwaki T, Kawasoe T et al: Molecular cloning of a candidate tumor suppressor gene, DLC1, from chromosome 3p21 3. Cancer Res 1999; 59: 1966. 23. Blute ML, Leibovich BC, Lohse CM et al: The Mayo Clinic experience with surgical management, complications and outcome for patients with renal cell carcinoma and venous tumour thrombus. BJU Int 2004; 94: 33. 24. Cairns P: Gene methylation and early detection of genitourinary cancer: the road ahead. Nat Rev Cancer 2007; 7: 531. 25. Hoque MO, Begum S, Topaloglu O et al: Quantitative detection of promoter hypermethylation of multiple genes in the tumor, urine, and serum DNA of patients with renal cancer. Cancer Res 2004; 64: 5511.