Document mB63J0MbVONE2n2RKNmrXBoyg

YHit - ' j - -C ._* -1 * .) ^ ^ /-> * t >J Jic - _ .iC ^ w' -L U U - ^ ^ wO ? L o j 0 J.. > / w ^' -*!- v - . u A x U, .. O' ''***" >r 1 - /i k,^ *r** rift *?U A ^ ~ ^ T*'' 1 * ' rr ,i .- . .. section as - viii 0,ihj^L'Je general specifications 1'/, '., ' T-. . ,, FOR -'-" . . .. INSULATION ......... . FOR MONSANTO CHEMICAL COMPANY ;plastics division 11 >. i-i w i *, { t - > . * w v.. . d l -:! J .1 '* ci w j s J 1 UV j. l.. DESIGN ENGINEERING DEPARTMENT,,*' ' ,, fnnofi^S . TEXAS CITY, TEXAS: CU r ; V" j(Rev^ 3 - September 15* 1955) "^ > *7 OS-VIII GENERAL SPECIFICATIONS FOR INSULATION Monsanto Chemical Company^Texas City, Texas I. SCOPE -r ~~ r - - -- All rinsulatlwi-lnstallations for the Texas City Plant of the Monsanto Chemical Company are to be made in accordance with this specif ication -except In ` those cases -where the -drawings specifi cally direct a deviation "from``these specifications or a separate specification is Issued to cover specific pieces of equipment and/or sections of piping. II. WORK BY CONTRACTOR -- --------- . r --u *r '-* * >r v- If`"the-work is performed by a contractor, he shall furnish, de liver and apply all material and provide all labor, transporta tion1, tools*-apparatus, scaffolding and anything else required for the proper execution of the work of Insulating, in accordance with this specification,- equipment and/or piping at the Monsanto Chemical Company Plant at Texas City, Texas, as directed by the Superintendent of Construction or his representative. The neces sary expansion Joints and nozzle flashings shall be furnished and installed as a part of the contract. This specification shall be considered as an Integral part of any contract for the installation of insulation. ` III. BID REQUIREMENTS Thicknesses of material given in this specification are those re quired for the material and service Indicated. Contractors may quote on alternate materials such as 85 Magnesia, "Unibestos," or "Armabestos" except that 85# Magnesia shall not be used where' the temperature is over 575F or where it is in contact with stain less steel or aluminum. The quotation shall'be on such a thickness of the alternate material that the maximum heat transfer through the proposed material will not exceed that through the Speeffle`<f thlckr. ness of the indicated material. - -- All bidders' shall state and guarantee the maximum rate of heat transfer through the completely Installed and finished insulation he proposes to furnish. For piping or cylindrical vessels up to 30" outside diameter, this guarantee shallbe BTU per hour,*per lineal foot of pipe'at the temperature'stated. For cylindrical vessels greater than 30" outside diameter, ourved and flat surfaces 9 the heat transfer shall be stated In BTU/per hour per square foot of the exposed metal surface tb which the Insulation1 is to be applied. r< . * C 003879 The bidder shall give the thickness, "K" Valve, and. maximum and minimum recommended temperatures of the alternate material and a description of it. Samples of the proposed material shall be be submitted when requested. The contractor shall also state in his porposal any changes in supporting angles or clips, tie wire, tension or anchor rings, method of,installation* etc., shown on the drawings, existing on the equipment or given in these specifications, that he considers necessary or desirable to give more satisfactory service from the insulation or lower Installed cost,,and give his reasons therefor. Unless such changes are stated, the bidders proposal shall con stitute his approval that these items are satisfactory for the particular ^service intended and his responsibility shall be deter mined. accordingly. ,,,, r. .... s. ,, .. REQUIREMENTS` AND LIMITATIONS `\ Vessels, equipment ahdUpiping designated shall be insulated with the materials and to the thicknesses designated in the tables for the service..designated. These services ares a. Conservation of heat b. Stabilization of operation .r T e. Operator protection -- - r-TM' '............ Jacketed., traced or, wrapped vessels, equipment or piping shall be insulated over such. Jacketing, tracing or wrapping with the materi als and to the thicknesses designated in the tables. The type and thickness of the insulation shall be governed by the higher temper ature material, whether it is in the Jacket, tracing or wrap, or in the vessel. ,, Where hot vessels, equipment or piping are designated to have "Operator Protection" insulation for the prevention of burns, the insulation shall be. Installed on only that portion of the vessels, equipment or piping with which the operator might come In contact in the usual performance of his duties. This would normally include only those portions of such installations that are lower than 81 above either the finished grade or a working floor or platform and are within three foot horizontally of a working platform. Such bum protection insulation shall be carried past these limits when it is desirable to close^small gap^ of two or.three feet in the insulation on.a pipe run; where It is neoessary to,obtain satisfac tory operator protection or where it is desirable for installation reasons, such as to obtain first class weather proof sealing of the insulation. Where cold or chilled water lines or chilled air ductwork are designated to have "drip-proof" insulation to prevent condensation,on their outside surfaces, this insulation shall con sist of a 1" thickness, of cork with the materials and application in accordance with'this specification or a sprayed or trowled coat ing of Lion Oil Oompany "K. Kote* of sufficient thickness to stop -2- C 003880 condensation at 95P dry bull? with 80 relative humidity. The thickness of "K Kote" shall not exceed 1/2" and if greater thick ness than this is required, the .1" of cork shall be used. The "K Kote" shall be applied in layers not exceeding 1/4" thick with, a drying period of at least 48 hours between coats. This "drip-proofing" is for use only on normal drinking water, or cool ing water lines or on chilled air ducts where the formation of condensate on the outside would be objectlonal, and is not to be used on lines conveying brine or other chilled or refrigerated liquids or materials, which lines are to be Insulated in accor dance with these .specifications for the temperature specified. SPECIAL .REQUIREMENTS Insulation shall not ,be applied to^yessels,,, equipment, or piping until all,hydrostatic tests required have-been successfully com pleted. ,, , , :v ,' V- V--.. Code inspection plates or stampings, name plates, etc., on vessels, equlpmeqt,^ or piping .'sh&ll be left permanently visible by cutting back the insulation where necessary to accomplish this. On low temperature service this opening shall be closed by a removable plug of the ..same material as the insulation used. On high tempera ture installations this opening shall be closed by a removable plastic insulation plug when so designated. These openings shall be permanently weatherproofed. ,~ All insulation materials .shall be non-corrosive, whether wet or dry. Plastic insulation shall, of itself, be non-corrosive whether wet or dry and shall contain a rust inhibitor which will, when the plastic insulation is made into plastic cement by the addition of Portland cement .or.other binders, prevent corrosion when moist or wet. Flanges of valves, fittings, and pipe line flanges shall be in sulated. The entire surface of screwed and flanged fittings and the entire surface of screwed and flanged valves up to the bonnet are to be insulated. . ,;u Equipment nozzles and flanges and vessel manholes shall not be in sulated unless specifically called for. Exchanger covers, manhole covers, etc..., which have bolt circles larger than 16" diameter shall "have the -center portion insulated. This insulation shall be held in place by #16 gauge galvanized wires fastened to nuts welded edgewise to the surface involved or by an equivalent method. This Insulation shall have the same weatherproofing as that on the vessel,. , _` ^ ,.ao il, Pumps and/or turbines when designated shall be covered with in sulation securely wired in place and pointed up with suitable asbestos cement. The insulation shall be covered with two coats of ,plastic asbestos cement troweled smooth and, with sufficient Portland cement added to form a hard surface. A coat of "Seal Perm" .1/8" thick,.when dry shall then be applied to give a weather proof finish. . - 3- 0 003881 Heat exchangers when designated shall be completely insulated except flange Joints. The insulation of covers, channels, bonnets and shells shall be Integral with their respective parts and shall extend to the point of clearance of flange bolts or studs. All attachments such as angle iron, studs, blank nuts, etc., made to the piece being Insulated shall be of the same material as the piece being insulated unless a different material is specifi cally approved by the engineering department. VI. CLASSIFICATION OP INSULATION For purposes of.reference, the insulation has been divided into seven groups asr'fallowstJ Group A - Towers, tanks 32F to 250F Group B - Towers, tanks, exchangers 100F. to 1200F Group C - Towers, tanks, exchangers Above 1200F Group D - Towers, tanks, exchangers 60F and lower Group E - Piping 100F to 1200F Group F - Piping Above 1200F Group G* - Piping 6oF and lower VII MATERIALS The following materials are to be used for the insulating work covered by this specification. The use of alternate materials will be permitted only with the specific approval of the Construction Superintendent or hisf representative of bids submitted on alternate materials in line with the section of this specification entitled "Bid Requirements." . Group A Materials All block insulation shall be foamed glass sawed block with edges beveled for a neat fit to the contour of the vessel. Bands shall be Monel Metal with a thickness of not less than 0.020". Stainless steel or aluminum bands may be used in certain locations when approved by Monsanto's representative. Weatherproofing shall Le Lion Oil Company "Seal Kote" vaporseal, medium grade for spraying; heavy grade for trowllng. Sealing and pointing material shall be Lion Oil Company "Low Temp." Group B Materials , r 'i All block insulation shall be calcium silicate-block such as "Kaylo" as manufactured by-the American Structural Products Co.or Thermobestc C 003882 -4 - assamiainiii . 'yMfeUfcMltLiilJlftfljjjj bB mm i U as manufactured by the Johns Manville Company. Bands shall be monel metal with a thickness of not less than 0.020". Stainless steel or aluminum bands may be used In certain locations when ap proved by Monsanto's representative. Tie wires shall be double dipped galvanized. Black annealed will not be acceptable. ; Reinforcing membrane shall be either 1" hex agonal poultry netting, galvanized before weaving and not lighter than 19 gauge or glass cloth such as n"Glasfab." Weatherproofing shail be Lion Oil Company "Seal Perm." Group C Materials ' " u All materials for Croup C are the same as those specified for ' r Croup B except that the high temperature Inside insulation blocks required for Group C shall be a blend of calcined diatomaceous silica and asbestos fiber with high temperature bonding agents, suitable for use at temperatures up to 1900P. Suitable high temperature Insulation blocks are Johns-Manville's "Superfex," Philip Careyls "Hl-Temp," Ehret's "Enduro" or Ruberoid's "Hl-Temp." Croup D Materials All block Insulation shall be 100# pure vegetable corkboard, steam baked," using as a binder nothing except its own natural resin. It shall have a thermal conductivity (at 60P) guaranteed not to ex ceed 0.29 BTC per hour per square foot per degree fahrenhelt tem perature difference. It shall have a weight not In excess of 71 lbs. per cubic foot. All edges shall be machine cut and squared. Suitable corkboard Is manufactured by Mundet Cork Corporation or Armstrong Cork Company. Bands shall be monel or stainless steel not-less than 0.020" thick. Tie wire shall be copper clad. Reinforcing membrane shall be asphalt Impregnated glass cloth such as "Clasfab." Weathercoating and sealing material shall be Lion Oil Company "Seal Kote." Croup B Materials All pipe Insulation shall be calcium silicate pipe Insulation such as "Kaylo" as manufactured by the American'Structural Pfodyctp Co. or "Thermobestos" as manufactured by the Johns-Manville Company in moulded pipe sections and segments. This material shall be suit able for use at temperatures up to 1200P without cracking, crum bling or otherwise failing mechanically. !. " l Weatherproof1 Jacket shall be an asphalt Impregnated rag or asbestos felt weighing approximately 45vlbs. per 100 square feet carrying the Underwriters1 Class C label, A suitable material meeting this requirement is JohnsrManyllle^sMbdlum Pilot Roofing. " -5- c 0Cr53 Metal Jackets for pipes, where specified as an alternate, shall be corrugated aluminum not less than .016" thick. Wire shall be galvanized Iron, the gauge of which will be as set forth in the "Wire Schedule" Table III. Bands shall be Monel.not less than .020" thick. Stainless steel - or aluminum bands may be used In certain locations when approved by Monsanto's representative. Group F Materials All' material s~for Gr6u^~ F the same'W"those specified for Group E except that the .high temperature Inside Insulation re quired for Group E shall be a blend of calcined dlatomaceous silica and asbestos fiber with high temperature binding agent, suitable for use at temperatures up to 1900P.' Suitable high temperature pipe insulation is Johns-Manville's "Superex," Philip Carey's "Hi-Temp," Ehret's "Enduro" or Ruberoid's "Hi-Temp." 'rrj f*5 /1 ^ c* 7"* ' y > Group 0 Materials Pipe covering shall be 100# pure vegetable cork meeting the same requirements a Group C insulation. Pipe covering shall have a factory ironed mastic coating.. ._ _ __ Tie wire shall be copper clad. Weather coating shall be as speci fied for Group E materials. Asphaltic nozzle sealing materials shall be as specified for Group D materials. Seam filler shall be manufactured by Armstrong Cork Company, Mundet Cork Corporation or Cork Import Corporation. Lap adhesive shall be Lion Oil Company "Brush Cement." VIII. APPLICATION The materials listed In Section 7 of this specification are to be applied In accordance- with the following requirements except as modified or further defined by Section 6 "Special Requirements" presented above. - Group A Application i Before proceeding with the application of Insulation to the surface of towers and tanks In this group, the entire surface of the vessel shall have been thoroughly cleaned and painted with a suitable Gllsonlte base paint, such painting being done under separate con tract not covered by this specification. Foam glass block shall then be buttered with "Low, Temp" applied In accordance with the manufacturer's recommendation on all edges and applied with full broken Joint or staggered Joint construction. The fqam ^lass blocks shall be secured In place by machine, stretched and fastened bands on not more than 9* centers. .If 3/4" bands are \'a` ' ^ - C 003884 used, 9" centers will be permissible. If 1/2" bands are used, the centers will be 6*. Each block shall be secured by at least two bands. A tack coat of "Seal Kote" shall then be applied over the outer surface. While this coat of "Seal Kote" is still wet, a layer of glass fabric shall be embedded into it with all Joints lapped at least 2" and sealed with "Seal Kote". A second sprayed or troweled coat of *Seal Kote" at least 1/8" thick when dry shall be applied oyer the glass fabric. This finish'shall be used either inside or outside. Fob-d%tailS-Hbf~Oxpknsi&n joints and'nozzle" flashing oh Group A vessels, see the attached drawings. Insulation thickness shall be as specified'in TablfeJI. When the insulation is 3" or more thick, it shall be.installed Ih.two or more layers with no layer being over. 2" thick. -When thelinsulatlon is in two or more layers, the inside layers may be secured with 1/2" monel or stainless steel bands .020" thick spaced on not over 12" centers with each block secured,by at least one band and the, outside ,laye,r bapded. as given in the first part of this section. The layers shall be applied Kith, full staggered joints both ..longitudinally and circumferen tially. ^ All faces of Jalocks in any layer which are In contact wi^h blocks in another layer shall be buttered with "Low Temp." Group B Application-1 1^ ` Before proceeding with the application of insulation to the sur face of towers, tanks, and exchangers in this group, the entire surface of the vessel shall have been thoroughly cleaned. These vessels may or may not be painted before1" the, insulation is applied. This is to be checked by the contractor with the Monsanto repre sentative in each case. If painting is required, this shall be done under separate contract before any insulation is applied. If painting is not required, the insulation contractor shall thoroughly clean the aurface be"fore any insulation Is applied. Calcium silicate blocks shall then be applied with full broken Joint or staggered Joint construction. The blocks shall be se cured in place by machine stretched and fastened bands on not more than 9" centers. If 3/4" banda^are^used, 9" centers will be permissible. If l/2" bands are used;"the.centers shall be 6". If the equipment is outside it shall be finished as follows: A very thih skim .coat of approximately 1/32" thickness, of asbestos and Portland cement mixed in the ratio of three parts to one part by weight" shall then b? applied and allowed to thoroughly air slack. The purpose of this coat of asbestos and Portland cement is to fill cracks between the blocks and.to provide a bond between the blocks and the weather coat, Wheti the cement coat is perfectly dry, there shall then be^applled a,thin coat of "Seal Perm" l/l6" thick when dry, and then 1" mesh hexagonal^, poultry netting shall be stretched tightly around the entire outer surface, pf the insula tion and secured either by lacing With 18,gauge galvanized iron wire, or by needie twisting the twp. selyage edges together to fora the seam. Directly over the poultry nettifigQftS88gie applied a -7- heavy sprayed or troweled coat of "Seal Perm" not less than 1/8" thick when dry. "Glasfab" may be substituted for the poultry netting. If Inside It shall be finished as follows: Poultry netting shall be neatly fitted and tightly secured to the Insulation. A layer of asbestos cement approximately 1/4" thick shall.then;be trowled over the netting. The surface of this layer shall be roughened to provide a good bond to the second layer. A second layer of a mixture of three parts asbes tos cement to one part portlahd cement by weight approximately 1/4" thick shall then be applied. The surface of this second layer shall be trowled to a smooth neat finish. For details of expansion Joints and nozzle flashing on Group B vessels see the attached drawings. For thickness of insulation use Table IJ. Group C Application.c `........... The same method of application is to be used for Group C vessels as has already been specified for Group B vessels, except these vessels may or may not be painted before the Insulation Is applied. This is to be checked-by the contractor with the Monsanto Construction Superintendent in each case. If painting Is required, this shall be done under separate contract before any insulation, is applied. If painting is not required, the insulation contractor shall thoroughly clean the surface to be insulated before any in sulation Is applied. Because of the higher temperature range of Group C vessels, a layer of high temperature insulation blocks must be applied first. From that point the calcium silicate blocks shall be applied directly over the high temperature insulating blocks. The thickness of insulation shall be as shown on Table II and details of expansion Joints and nozzle flashing shall conform to the attached drawings. Group D Application Before proceeding with the application of insulation the entire surface of the vessel shall have been thoroughly cleaned and painted with a suitable Gllsonlte base paint, this painting being done under separate contract not covered by this specification. The vessel shall then be insulated with scored corkboard or with cork lags in accordance with the vessel diameter and insulation thickness table as given in Table I and Table II. The cork boards shall be applied directly to the surface of the vessel under a spring to a diameter substantially greater than that of the vessel. These cork boards shall be perfectly dry and free from asphalt or other Ifeypes.of coatings. When the course is complete, cork boards shall'then;be, compressed down'to the surface of the vessel by use of cable or rope and load binders, and securely banded in place with 3/4" wide.metal bands machine stretched and fastened on 6" centers. Each succeeding layer,of. cork board shall be applied in exactly the same fashion circumferentially. After the last layer - 8- C C93GSC tux. of cork board has been applied, a tack coat not more than l/l6" thick when dry of "Seal Kote" shall be applied directly over the outer cork surface. While this coat of "Seal Kote" Is still wet, a layer of asphalt saturated glass fabric shall be embedded Into it, with all Joints lapped at least 2" and sealed with "Seal Kote". A second sprayed or troweled coat of "Seal Kote" at least 1/8" thick when dry shall be applied over the glass fabric. This finish shall be used either inside or outside. Vessels That Require Lags Shall be Insulated as Follows; Lags beveled to the proper angles to exactly fit the bare iron surface of the vessel shall be applied dry and securely banded on 9" centers and with 3/4" wide machine stretched and fastened bands. Lags shall be slightly oversize so that when tightened by bands, vertical Joints will be air tight. Each succeeding layer of lags shall be applied over the preceding layer in exactly the same manner -until the proper thickness of insulation has been ob tained, after which :the weather proof finish shall be applied in exactly the same manner as prescribed for vessels insulated with cork board. _ __ _ .. Vessels with Convex Heads Shall be Insulated as Follows: The vessel heads shall be insulated with cork board scored two ways and cut to proper angles in order to make perfect fitting board covers. The cork boards applied to side areas of such ves sels shall be allowed to extend beyond the tangent point at which the head and vessel shell are Jointed a sufficient distance to contain the thickness of the vessel head insulation. This specifi cation shall be followed on vessels with welded heads only. Vessels with Flanged Heads Shall be Insulated as Follows: The cork board appliedjio vessel sides shall be abutted firmly against the head flange. When the proper thickness has been reached for vessel side insulation, cork boards shall then be ap plied over the flange proper and around the outer surface of the side shell insulation from the back side of the flange to a point 6" toward the center of the vessel, and extending from this point toward the end of the vessel to a perpendicular line striking a tangent on the outer extremity of the convex head plus as many inches as the thickness of the insulation to be applied. Not less than two bands shall be securely fastened around the outer surface of this flange cover at its inner extremity or at the end near the center of the vessel. A cork disc of specified thickness shall then be inserted in the circle formed by the outer extremity of these lags forming the cork cover. This disc shall be secured in place by driving wood skewers through the cork lags, and into the edge of the disc. It shall further be secured in place by applica tion of waterproof cement or other suitable and similar material between its edge end the cork lags or boards. The entire surface of such vessels shall then be finished in the same manner as pre scribed above. C 003887 -9- In every case on Group D equipment, at the Junction of a nozzle at the vessel surface, the insulation shall be applied in accor dance with the attached drawing. No metal flashing will be used on this type of vessel, but a seal between insulation surfaces or insulation and metal surfaces will be provided by the use of bitumastlc or similar material as Indicated on the attached drawing. Group E Application ' .. The pipe to be insulated may or may not require painting before the insulation is applied.- This^is_to;be checked by the contrac tor with the Mbnbanto Construction Superintendent in each case.1 If Tpirrtin^ is required, this shall be done under separate con tract before any insulation is applied. If painting is not re quired- dthe insulation contractor shall thoroughly clean the sur face to belK insu; laC-t_ePd; ib-< efore any ins ur lation ds 'app'lied. " Pipe Requiring Single Layer Insulation: The calcium silicate pipe covering shall be applied to the pipe from 1/2" to and including 10" diameter in two full half round sections. Larger pipes may~6erinsulated with eitherTxa$f 'round ?' or with segmental pipe covering. These sections shall be wired in place by means of galvanized wire tightly twisted about the outer surface^of^the insulation proper, the gauge of the wire to be as "'Indicated ^bn -'Wire Schedule", Table II. All logitudinal and circumferential seams 1ihall be neatly and thoroughly pointed with asbestos cement. The weather-coat for outside pipes shall be 45 lb. roofing felt applied directly around the outer insulation surface in the following manner: ` The roofing felt shall be lapped 3" circumferentially and 2" logitudinally. On hirizontal lines, the 3" lap shall be placed in such a man ner that the-outer lapping edge of the roofing paper shall fall at a point approximately 15 degrees below the horizontal center line of the pipe to insure against water getting under the roof ing paper. - r: r On lines 4" in diameter and smaller, having insulation thickness2" and less, the roofing felt shall be securely wired in place by means of copper clad wire located on 6* centers and twisted until tight. On lines larger than 4" in diameter or4**" diameter lines having insulation thickness in excess of 2" the roofing felt shall be securely banded in place by means of 1/2" x .020 machine stretched and sealed monel bands''on'9" centers. In-places where they are permissible, the aluminum bands 'shall 'be installed in the same manner as given for monel bands. -err f" :^T-H:603888 . ..rL.-. 10 - . -,r In place of 45 lb. roofing felt used as a weather coating, a per missible and acceptable alternate shall be corrugated Aluminum sheeting. The aluminum sheets after they have been wrapped around the pipe insulation shall be fastened together with aluminum sheet metal screws. The sheetB shall overlap 2" on the longitudinal seams and 2" on the circumferential seams. Inside pipes shall'haveTall Irregularities in the insulation smoothed out with finishing'cement. Six ounce canvas shall then be glued.over the entire surface.or sewn in place with at least 3 stitches per inch. If, glued the laps shall be at least 3" and face down. " ' ." Inside valves and fitting insulation shall have irregularities smooth out with finishing cement and then have 6 ounce canvas glued to the surface. When the pipes^arp, nside.a cell; they ihall be finished with si laminated asbestos jacket such as Philip Cary 38# Fire Guard Jacket instead of the Sanvas specified above. This Jacket shall be lapped at least 2" circumferentially^and 2" longitudinally and banded with 1'/2" bandsC,or n 9 "'centers.T u lu 'v ;'"~--i .. -v Pipes Requiring Double" Layer Insulation: " The first layer of pipe covering shall be applied on lines, 10" arid smaller in two full half round sections. These sections shall be secured about the surface of the pipe by means of galvanized wire on 9" centers. All longitudinal and circumferential seams shall be neatly pointed with asbestos cement and then in turn a second layer of pipe covering shall be applied with longitudinal seams staggered to the greatest possible extent and the circumferential seams staggered not less than 6". This outer layer of pipe covering shall be secured in place by means of galvanized wire on 9" centers and pointed and weather proofed in exactly the same manner as specified for single layer insulation. Pipes Requrlng Segmental Pipe Covering: The pipe should be insulated with calcium silicate blocks curved and beveled1to fit the exact circumference of the pipe or inner layer of Insulation. 1 These segments shall be wired on 9" centers. All longitudinal and circumferential Joints are to be staggered and all seams are to be pointed with asbestos cement. The weatherproof finish to be applied shall then be the same as specified for single layer insulation. ., Valves and Fittings: ^ \ Welded and screwed valves and fittings 4" and smaller may be in- '' sulated with mineral wool cement. The cement shall, be allowed to dry thoroughly, then a skim palm coat of finishing cement, meeting the same specif icatipns^ as ^.that applied over block insulation shall be applied over the outer surface of the mineral wool cement. When this has dried thoroughly}. ^gpal^Perm" shall be palmed or throweled v 'c 003889 on the fitting to a thickness of not less than 1/8" when dry. Special care shall be taken that the "Seal Perm" is spread at least 6" back of the terminal point of the adjacent pipe covering roofing paper Jacket so that no edges of the roofing paper are visible at the point of Junction between fitting insulation and piping insulation finish. Welded fittings larger than 4" shall be insulated with calcium silicate pipe coverings or blocks cut and pre-formed to fit the fittings. Joints on these segments shall be tightly sealed with sodium^silicate andasbestos fibre or other suitable material so that the fitting when finished will consist of two half fitting covers. These two halves shall then be applied to the fitting and wired in place with galvanized wire crossed from bottom to top of fitting and twisted tightly. A thin skim coat of asbestos cement shall then be applied and when thoroughly dry, over this coat, "Seal Perm" shall be applied to a thickness of 1/8" when dry. The "Seal Perm" shall be spread at least 6" back of the ter minal point of the roofing paper as described above. This method of insulating may be used on fittings"smaller than 4" if desired. Flanged vdlves and-fittings and flanges smaller than 8" are to be insulated with either block or pipe covering of same thickness as specified for the adjacent piping, secured and wired in place with galvanized wire and finished-in the same manner as for welded fittings. '" ''' Flanged valves, fittings and flanges 8" and over are to have an extra layer of "Seal Perm" 1/8" thick when dry, with a layer of 1" mesh galvanized poultry netting or glass fabric applied between the two layers of ."Seal Perm",'as specified On Type:A vessels:-I . Group F Application Methods of application for Group F will be the same as for Group E except that an inner layer of high temperature insulation will be used. The thickness of pipe covering is designated on Table II. Group 0 Application Before proceeding with the application of Insulation, the entire surface of the pipe shall have been thoroughly cleaned and painted with a suitable Gilsonlte base paint, this painting being done under separate contract not covered by this specification. - Plfsb Requiring Single Layer Insulation: ' Cork pipe covering shall be applied with longitudinal and circum ferential seams tightly sealed with seam filler. Cork pipe cover ing shall be held in place by means of copper clad wire on 4" centers twisted tightly about the outer surface thereof. Then in turn, 45 lb. roofing felt shall be applied, and fastened in exactly the same manner as prescribed under Group E pipe cohering, except it shall be lapped 180 degrees circumferentially and the lap shall be sealed with "Brush Cement." This finish shall be used either inside or outside. q 003890 12 PipesRequiring Multiple Thickness Insolation: The first layer of pipe covering shall be applied In tafe sane manner as prescribed above. All seams shall be tightly Sealed with seam filler and the covering shall be secured In place by means of copper clad wire on centers, then In turn a second layer ot pipe covering shall be applied with all longitudinal and circumferential seams staggered with respect to those of the first layer to the .greatest possible extent and securely sealed with seam filler. This layer shall be wired In place In the same manner specified for single layer application and shall be finished with roofing felt, sealed and secured as specified under single layer Insulation. ' 0 >-;? ............ " ' . , , Vapor Seals: *r,i - - .; On long runs of piping Insulation and at the point of junction of all piping Insulation with fitting insulation, the following type vapor seals shall be made: , . Abutting ends of fittings and/or cork covering shall be thoroughly coated with "Brush Cement" extending over the outer surface of the pipe covering, across the pipe covering end and along the bar iron surface of the pipe for a distance of not less than 6". Such seals shall be made on*long runs at Intervals of not more than 40' to insure against loss of a greater portion of the line insulation in the event a vapor seal is lost at any point along the line while in operation. Pipe Hangers: All pipe hangers shall fit over metal shields placed on the outside of the cork insulation. If it is determined that the weight of the pipe and the spacing of the pipe hangers or saddles Is such that the weight Imposed upon the cork pipe covering is excessive, a small wooden half moon, 2* wide shall be placed arond the bottom one half of the bare iron pipe and extending from the outer sur faces of the bare iron pipe to the inner surface of .the saddle. Cork pipe covering ends shall then be sealed against this wooden block In the same manner as prescribed for seals and junctions of eork pipe covering on fitting Insulation. Metal Jackets: Cork covering in locations likely to be walked on -shall be finished exactly as specified elsewhere herein and shall then receive corru gated aluminum jackets formed to fit around the surface of the cork insulation finish, which jacket shall be secured in place by aluminum bands. - These jackets shall be not less than .019" thick. After receiving a finish such as specified elsewhere herein that portion of vessels immediately adjacent to platforms or. places frhere operators will normally be at frequent intervals, shall re ceive a corrugated aluminum Jacket not less than .019* thick over the already applied vapor tight finish to whatever extent necessary to protect the vapor tight finish from being gouged or broken ac cidentally by these workmen. C 003891 - 13 - H. WORKMANSHIP The Intent of this specification Is to Secure a first class Job In all respects. The workmanship shall be of the highest quality throughout, and the contractor shall furnish a competent superin tendent experienced In this class of work. The pipe covering shall be applied as soon as the work on the f&ping -'And equipment will permit, and work shall be started Immediately upon notification by the Superintendent of Construction to do so. After the work covered by this specification has been completed, ' all rubbish and debris resulting from such work shall be removed . and the premises left In a condition satisfactory, to the Monsanto Chemical Company. ___________________ . ___ During the progress of the work, the premises shall be maintained In a neat condition satisfactory to the Monsanto Chemical Company. X. INSPECTION __ -__________________ _______ - The Superintendent of Construction or his authorized representa tive shall have the right to"inspect all work and material at the factory or the site and any work or material found to be de fective or which does not meet the requirements of the Inspection shall be replaced by the Contractor at his own expense. Such In spection, however, shall not relieve the Contractor from full re sponsibility for the quality or correctness of his materials or work. XI. PROTECTION AND COORDINATION The Contractor shall at all times assume full responsibility for the complete protection of his work and those of adjacent trades at all times. He shall extend full cooperation to and coordinate his work with other crafts concerned at all times so the complete project will proceed in an expeditious manner.___ 1_____ XII. GUARANTEE Before,final acceptance by Monsanto Chemical Company the Contractor shall guarantee, in writing, for a period of one year all of the materials and workmanship furnished by him. The period of one year is to start from'the date of final acceptance by the owner and the Contractor shall, at his own expense, repair or replace any material or work found defective during the guarantee period. XIII. ATTACHMENTS The following tables and drawings are attached hereto and.form: a part -of- this specification. . They apply to~the work with -the same - force as though they were a part of the written matter of this specification: "-*14 r* C 003892 iTMl :iililliW --filj Table I - Types of Vegetable Cork Insulation of Different Thicknesses for various sizes of Vessels. Table II ___ - Thicknesses and types of Insulation. Table III - Wire Schedule Table IV - Nominal Cork Thickness Dwg. No. A - SD-624 - Typical Vessel or Tank Nozzle ..Plashing and Insulation , Dwg. No. A - SD-625 - Typical Pipe Flange Plashing ---------------------and Insulation---------------- Dwg. No. A - SD-626 - Column Insulation Details Dwg. No. A - SD-627 - Typical Manhole and Nameplate --------------- Insulation Details for Tanks ------------- Dwg. No. A "- SD-632 - Typical Tank Insulation Expansion Joint Dwg. No. A - SD-633 - Application of Insulation-to Metal Projection Attached to Low Temperature Surface Dwg. No. A - SD-634 - Typical Reinforcement of Weather Vapor Barrier at Corners Dwg. No. A - SD-635 - Rigid Insulation of High Tempera ture Vessel Nozzle , Dwg. No. A - SD-636 - Insulation Details for High Temperature Vessels >*! 15 - ` C 003893 TABLE I TYPES OP VEGETABLE CORK INSULATION OP DIFFERENT THICKNESSES FOR VARIOUS SIZES OF VESSELS BEVELED CORK LAGS Thickness of Insulation li" 2" 3" 4" 6" 8" 10" 12" 20" to 60m dia. Beveled Cork Lags 1 lyr. 1 lyr. 1 lyr. 1 lyr. 1 lyr. 2 lyr. 2 lyr. 2 lyr. 60" to 8*-0" dia. Beveled Cork Lags 1 lyr. 1 lyr. 1 lyr. 2 lyr. 2 lyr. 2 lyr. 60" to 8'-0" dia. Scored Cork- board 1 lyr. 1 lyr. 2 lyr. 2 lyr. 8'0" to 10*0* dia. Scored Corkboard 1 lyr. L^ove lO'O" dia. Flat Corkboard 1 lyr. 1 lyr. 1 lyr. 1 lyr. 1 lyr. 2 lyr. 2 lyr. 2 lyr. 2 lyr. 3 lyr. 3 lyr. 4 lyr. 4 lyr. 4 lyr. 4 lyr. C 003894 & & po CO o CoOoCOoCoO oCO cCOoocoooCrOcoao8888B8'B8 * AEHnAEHnAHE mrEainHAE moe i ecu AtwN. ecoAEcomEAconea- AaE m- ecu abecvei m 8 8 ooo V CO CO CO CO CO CO CO CO t) o ooooo C-Q> ur\ 8 8 8 8 8 o -P o dt AW JL eUOsCOoCuQUOOUCOUoCOCOoCQ$ EoMfCaOoE-f!aCQo AAoMAmeCU eCU ACUnACUneonACOmAe" AAmeinVfcO veo eCU ein eCM VeO e 9, orH & O P s CO o Am A CO CO CO CO CO CO CO COCO C--O 8 eS O Oooooooocooo Ogg CO o AcvMnAMnAoHoHne AnAne Am* e e e e AAAAAAACUOlOJononACUOOCUA P c o o o oooooooo-pd oco voin88S88889 8 A=N 3 8 <8 CQCOCOCQCO CO COCO CO AEAOcAHOENAOAEAOcCHOEUoCw:CQ: UXEoCJECAVQmimeoOoOEAnCnEACOnOOeAoCEAAOMEsoin-ICefCaUOAsoEHef0aC1 eQoIA e oCO CoOoCOoCoOCSCOOEOCOOECOOOCOCOoOCEOOECCOOoCOo&IfCaOoEMfaCoO o EA EHHEHEHErlHAHnCAolMOnJsNeCIACnOAnCeOeOIeOIeOeICeO CO ASt +o> <d Ph_ cu w5 o V O O OOOOOOOOAo CO ^a88888889 flo 8 <8 COCQCOCOCQCQCQCQCOCQCO CO CO ooooooooooomragogo <3 A A AAnAnAuCU OJAWCOCOANe hs_e coe a A H H CVJ COA A CU CU CO W ;Si I s CO CO CO CO CO CO CoO CoOoCOoCoQCoOCOOOOCoOoCQoCQOOgfajCoO o SEE EE E e sssss AoHnAns s e AoHns e s Am A AAAAAAAACUCUCUCUCUCUCUCUCU CM o CO h V tD d w o _ o ooooooooo +o> oco e8 i8 cOocOocOocOocOocOotpocOocOocOogOcoOcogOc|oMOco o a 8 8 88.88899 c = , 3 A AAcAMAcA*HA|fMU&CcUJtCUs CAUmCh|OMeCOACnOAnCeU coeCU A hha tt)- i+J o UU xgO_3 nAacaVh3t *OS- (OO'+H>J e 8 s P> . 3 to m o J<U-t fPt JS- o S CO CO CO co co coco COCOOOOCQCQOCOOCOOOEHCQgjCQ o_ o o _ _ oo o_ o fa o fa o s Ame e AnAnAne e Ame Ame AnAne e e e AAAAAAACUCUCUon COA AACUACUlA e Hw *d H OOOOOOOOOO-Jj EEEEEEEEES, o 0 ScOCOCOCOCOCQCOCO^OQ_____ co t--vo irvA a on m cu An co H-3 oooooooomoragra EE EE E E, OGO Efaj COO s AnAne e AnAne Ame Ame e e e e e e A A A CU CU CU on COA A tf\vo VO CU ITS cu VO SS9 <mo do +j O r? fl CM M 8OOO CO CU A oooQoooic} I I I O A CU onA ITWO A CU QOOOOQOQOQQO P-p-P-PP-P-P-P-P-p-P-P o o o o o o o op O O Q a on cu a A cu on A invo o IIII ______________A 8 In 8 in 8 jn on ona a ir\ wv o-oooooooqqq p-p-p-p-p-p-p-PP'P-p R8P OOOOQ ------- in O in`_iO____m___o_ q cu mroA a ininvo C~- 003895 t; V TABLE III WIRE SCHEDULE Pipe Size 1/2" to..b'" 8" to 16" Over 16" Standard Thick Hot Pipe Covering lb ga. galv. on 91' centers (Average) 12 ga. galv. on 9" centers (Average) 12 ga. galv. on 9" centers (Average) 1/2" to 5* 6" to 16" Over.16" 11/2" Thick Hot Pipe Covering lb ga. galv. on 9J centers (Average' 14 ga. galv. on~9" centers (Average! 12 ga. galv. on 9" centers (Average! 1/2" to 4" 5" to 15" Over 15" 2" Think Hot Pipe Covering lb ga. galv. on 9U centers (Average! 14 ga. galv. on 9" centers (Average! 12 ga. galv. on 9" centers (Average! 1/2" to 4" 5" 6" to 12" 14- Over 14" Double Standard Hot Pipe Covering lb ga. galv. on 9" centers (Average) 16 ga. on inner layer 14 ga. on outer layer on 9" centers 14 ga. galv. on 9" centers (Average) 14 ga. on inner layer 12 ga. on outer layer on 9" centers _ . 12 ga. galv. on 9" centers (Average) For Combination Hot Pipe Coverings use the Following Formulas 2 1/2" to 9" o.d. covering 10" to 19" o.d. covering Over 19" o.d. covering 2 1/2" to 12" o.d. covering Over 12" o.d. covering 16 ga. galv. on 9" centers (Average! 14 ga. galv. on 9" centers (Average 12 ga. galv. on 9" centers (Average, Roofing Jackets lb ga. galv. on 6" centers (Average) 14 ga. galv. on 6" centers (Average) 1/4" to 3" 3 1/2" to 10" 12" to 20" Light Duty Thickness Vegetable Cork Pipe Covering 14 ga. copper clad steel on 4 1/2" centers 12 ga. copper clad steel on 4 l/2" centers 10 ga. copper clad steel on 4 l/2" centers 1/4" to 1 1/2" 2" to 8" . 9" to 20" Standard Thickness Cork Pipe Covering 14 ga. copper clad steel on 4 1/2" centers 12 ga. copper clad steel on 4 1/2* centers 10 ga. copper clad steel on 4 l/2" centers C 003896 TABLE III (Continued) 1/4 to 3/4" 1" to 6" 7" to 20" Heavy Duty Thickness Cork Pipe Covering 14 ga. copper clad steel on 4 1/2" centers 12 ga. copper clad steel on 4 1/2" centers 10 ga. copper clad steel on 4 1/2" ^ centers .. ,, .... 1 ^ ________ r ' o. ) nits " ... C 003897 TABLE IV Nominal Cork Thickness All dimensions are in inches Pipe Size 1/4 3/8 O.D. Pipe .540 .675 Light Duty Standard Cork O.D. Cork o;d. Thickness Covering Thickness Covering 1.35 3.25 * - ..... 1.85 4.25 1.28 3.25 1.78 4.25 Heavy Duty Cork O.D. Thickness Covering 2.88 6.31 2.82 6.31 1/2 .840 1.20 3.25 1.70 4.25 2.73 6.31 3/4 1.050 1.35 3.75 1.85 4.75 2.63 6.31 1 1.315 .-,1.47 4.25 2.00 5.31 2.97 7.25 1* 1.660 1.48 , 4.62 2.32 6.31 3.10 7.87 U 1.900 1.42 4.75 2 2.375 1.47 5.31 2.50 2.44 6.90 7.25 2.99 3.25 7.87 8.87 2.875 1.37 5.62 2.50 7.87 3.00 8.87 3 3.500 1.56 6.62 2.68 8.87 3.06 9.62 3* 4.000 . 1.62 7.25 2.81 9.62 3.56 11.12 4 4.500 1.68 7.87 2.56 9.62 3.31 11.12 5 5.563 1.65 8.87 2.78 11.12 3.78 13.12 6 6.625 1.81 10.25 2.78 12.18 4.00 14.62 8 8.625 1.78 12.18 3.00 14.62 4.00 16.62 10 10.750 1.93 14.62 3.00 16.75 4.00 18.75 12 12.750 1.50 15.75 3.00 18.75 4.00 20.75 14 14.000 1.50 17.00 3.00 20.00 4.00 22.00 16 16.000 1.50 19.00 3.00 22.00 4.00 24.00 18 18.000 1.50 21.00 3.00 24.00* 4.00 .26.00 20 20.000 1.50 23.00 3.00 26.00 4.00 28.00 iese dimensions are for a guide as to clearance required. Actual dimensions *111 vary between manufacturers. ' ------- - C 003898 LqHS! TUDlHAL / /u^f/fc-aEva ^ . * 1 1 Jt ; seciqio+i: \ Ji, | ' ** :_ \ ClgCuMFpEhJT/AL 3EC TlGhJ SEt-JEKAt-^No TES f .T\.- * ,".>iV.45? `Vlj . *?? Vv . *. >>* ' *V * .* A Fill 'Space VJEA TAEPCOAT XFP>,/>/b~ BUTTERir4<Sr \To Ttfg ./&% 2. Fill Sf^e- of 3. > F*r-A-'%'L\yy''S tjohi'.mbtfC K#r&> ' Stze^CAPFYiaMF ^Lo^ T4Ap* ye 7&oMTfb^F3jiroc.*C. $f*OUblE>:ttfiSiJLATtOhJ F7b\ C04?*bi%:t*fy 9ra ' '--1 ; f 0! 003899 FojZ CdpfdJOP FoAN&lAs INSULATION. Exp/ins/on}~~lJo/n r For Calcium Silicate: INSULATION Df ta l < Cenepal Notes ; --* /- INSTALL EXPANSION JOINTS AT EaCN INSULA TlON . Support. 2. insulation of ColPTops To BP Held in Place: . With CEMENT 4 BANOS OnlY. Use No DfPJCCT Metal Attachment* Suca a* Nelson Stuos. 3. Install. Oa/a Lpy'g.iz. Op Gjlh&s ^3./c 'a*Sc>o.d Jm `/s" 'Cehl Mot*" O/W. All. Cot^ Oa. Foamsilhs Poa. A Vhf>g>&. Saal. . -. ?* fW'- C 003901 < ') r.;,. ~>. **V*>-";.vV". USE ' `-5ci" 1 j*-* \ -;X'-.i'' V ; - -" Monsanto Cbkmical Company PTKU&r tea C/TYf TEy. : .CHOi LUPttic--U- N- S- ULA T/ioN f%r-* ,/LHg vm-j&a. ji k Kr" '. n i* ' m r ' - J- i | |3vy<s* Ho; - &2& : sii 003902 mMLiM ---.11. CVS THSfk Jail*J-rjr , ' - Sif - Two Pi-ftass pA.Sift.ia w ^COwnM* T* INrUwOwUwSd. PaomItTop Tb Bottoiv^ ' 4^ -' aftNiRAU-NatiiS:'. .*:> l. 'kjsuwtiovi .OtT^lul <i'ctww A4K<b:^s;':;" CoR,K. Ot a** ,X . - .-, 1'i -. V3.Jhv^'^A. j :?:->. . ; .-4 X;- 71 -'if -*'*jJ.T<>^'.'r-",/-r--./ r,L7d1--fc-PR..?*r.,,, X> 003903 iwtr. - - ~, icir . i ':.r-'.-.-* . - ; : !-fe- :.. ' -'.'tyr '"* -= * n^ ~~ - . ,'J~apsi-- - Olc^SANTO^yHKMICAI. VJOMPANY ?fe7 mm .^v * :. Fi < &-i A~... . r* ;.. ;* JG>SG-*~ * .- * NO. . .oAn - * c 003906 Monsanto Chzmigal Company PROJECT vsto. tNS.U&T lOKffcF. YUOjH SMfg.R^tffee,V35EU UOZlt-fc dA'.iJ7- * sd^gSS: W INSUU^VT iOW ( RIGID INSULATION OF V.SSE.L PLANTS "Se./v.v- PtRM' WEMH6B. P|.OOPIM^ SE.ALIN<=> OF VfcSS&L INSULATION AROUND UNINSULATED FLANG&. ,Z * ' Mon8anto Chemical Company r