Document VKELZZjd80oKQYwNda50xLqvK

OXFORD UNIVERSITY PRESS Volume 16 number 10 October 1995 H&ES/Tox. Library Oct 30, 1995 R&S 148948 Carcinogenesis voito mi uipp-MXV jew. ivrt Molecular analysis of mutations induced by 2-chloroacetaldehyde, the ultimate carcinogenic form of vinyl chloride, in human cells using shuttle vectors Tomonari Matsuda, Takashi Yagi1, Masanobu Kawanishi, Saburo Matsui and Hiraku Takebe1*2 Center for Environmental Quality Control. Kyoto University, 1-2 Yumihama. Otsu, Shiga 520 and 1 Department of Radiation Genetics. Faculty of Medicine, Kyoto University. Yoshida-konoe-cho, Sakyo-ku. Kyoto 606-01. Japan 2To whom correspondence should bo addressed Vinyl chloride (VC) is a carcinogen associated with human and animal cancers. The ultimate carcinogenic form of VC, 2-chloroacetaldehyde (CAA), has been suspected to be mutagenic and we confirmed the mutagenicity of CAA using a modified shuttle vector plasmid. Base sequence analyses of 109 mutant plasmids with mutations in the supF gene, which were treated with CAA and propagated in the cultured human cells, revealed that more than half of the single base substitutions were G:C to A:T transitions with eight hotspots. The majority of the mutations involving G:C base pairs were in 5'-AAGG-3' or 5'-CCTT-3' sequences suggesting that these sequences are the main targets of mutagenesis caused by CAA. Introduction Vinyl chloride (VC*) is one of the widely used raw materials in the polymer industries. Many epidemiological studies and case reports have demonstrated that VC is associated with cancers in liver, brain, lung and the haematolymphopoietic system. The IARC working group classified VC as belonging to Group 1, which represents the substances with carcinogenicity supported by sufficient evidence in humans and animals (1,2), Vinyl chloride is metabolized by the cytochrome P450dependent monooxygenases to 2-chloroethylene oxide and then rapidly converted to 2-chloroacetaldehyde (CAA) in mammalian livers (3). 2-ChIoroacetaldehyde reacts with DNA bases in vitro, resulting in production of four known cyclic adducts: 1 .M-ethenoadenine (eA), 3Wl-ethenocytosine (eC), W2,3-ethenoguanine (N2,3-eG) and 1 ./^-ethenoguanine (1,N2eG) (4). These cyclic adducts were detected in liver DNA in rats following exposure to VC (5,6) and have been shown to cause mutations (7-13). Recently, mutations involving G:C to A:T transitions in the second nucleotide at codon 13 in the c-Ki-r5-2 gene were detected in liver angiosarcomas in VC plant workers (14). This type of mutation could be specific to VC since the same type of mutation was found in bacteria exposed to VC (913,15). We intend to confirm whether this VC specific mutation arises in human cells. The shuttle vector plasmid, pZ189 (16) and its derivative pSI89 (17) and pYZ289 (18) have been widely used in assessing the carcinogen-induced mutations in mammalian `Abbreviations: VC. vinyl chloride. CAA. 2-chloroaceialdchyde, IPTG. tsopropyl-P-o-lhiogalactoside, X-gal. 5-hromo-4-chloro-3-indoyl-fi-i>galactoside. PBS. phosphate hullered saline. Oxlord University Press cells. Each type of the plasmid carries a bacterial suppressor iRNA gene. supF, as a target gene for mutagenesis. The supF gene is small enough (176 base pairs) to facilitate rapid sequence analysis in many samples. We constructed a new shuttle vector plasmid, pMY 189, by modification of the plasmid pZ!89 to make the plasmid sequence suitable for the fluores cence dye primer cycle sequencing method. We treated the shuttle vector plasmid pMY189 with CAA, the ultimate carcinogenic form of VC and transfected the plasmids to human fibroblast cells. The plasmids containing mutations in the supF gene were detected with the indicator bacteria system developed by Akasaka et al. (19) and the mutations were analyzed by the automatic DNA sequencing. Materials and methods Chemicals 2-ChIoroaceialdehyde, ampicillin, chloramphenicol, nalidixic acid, isopropylp-D-ihiogalactoside (IPTG) and 5-bromo-4-chloro-3-indoyl-p.D-galactoside (X-gal) were obtained from Wako Chemicals (Osaka, Japan). Restriction endonucleases and other enzymes were obtained from Takara Shuzo (Kyoto, Japan). QIAGEN plasmid-kit and WizardTM Minipteps DNA Purification Systems were purchased from QIAGEN Inc. (Chatsworth, CA) and Promega (Madison, WI) respectively. Cells SV40-transformed human fibroblast cell lines were used. A normal human cell line WI38-VAI3 (20) was obtained from the American Type Culture Collection (Rockville. MD). DNA repair deficient XP20S(SV) cells were previously established by us from a Japanese group A XP patient (21). All cells were cultured in Dulbecco's modified minimum essential medium (Nikken, Kyoto, Japan) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). Plasmid construction The shuttle vector plasmid pZI89 was modified to be directly applied to the dye primer cycle sequencing method followed by the automatic DNA sequencing by a 370A DNA sequencer (Applied Biosystems, Foster, CA). Two 42-mer oligonucleotides were synthesized by a 380B DNA synthesizer (Applied Biosystems). One contains the sequence of the -- 21M13 fluorescent dye-labelled universal primer (5'-TGTAAAACGACGGCCAGT-3') which is commercially available (Applied Biosystems) (5'-GACGAATT CIGTAAAACGACGGCCAGTGAGCTCGAATTCTTG-3'). The other is its complementary sequence. (5 '-CAAGAATTCGAGCTCACTGGCCGTCGTTTTACAGAATTCGTC-3'). Both oligomers coniain coRI restriction sequences (5'-GAATTC3') at their 5'- and 3'- ends and a Sad restriction sequence (5'-GAGCTC3'). Twenty micrograms each of these oligomers were annealed by heating and cooling in a solution of 750 mM NaCI and 75 mM Na* citrate. After ethanol precipitation, the annealed fraction (double strand DNA) was digested with tv)Rl and inserted into the coRl site of pZ189 with T4 DNA ligase. The direction of the inserted oligomer was confirmed by the 5tid digestion and the DNA sequencing. The modified pZI89 was named pMYl89 (Figure 1) Bacterial strains The indicator Estheticlua tali strain KS40/pKY24l (19) was kindly supplied from Dr S.Akasaka. Division of Industrial Health, Osaka Prefectural Institute of Public Health, Osaka, Japan. KS40 is a nalidixic acid-resistant (jtyrA) derivative of MBM7070 |/r Z (am) CA7070 tacYl HsdR HsdM A (araABC leu)7679 RalU $alK rpsL thi\ (22). which has been used for detection of the mutated pZI89. Plasmid pKY24l was constructed by Akasaka el al. (19) and contains a chloramphenicol resistant marker and a gvrA (amber) gene Escherichia coli KS4()/pKY24l cells carrying the active supF gene are sensitive to nalidixic acid, whereas the cells carrying the mutated supF form colonics on plalcx containing nalidixic acid, chloramphenicol and ampicillin To ensure (he selection of the mutated supF gene, IPTG and X-gal were 2389 R&S148949 T*Ma(suda et aL v iddcd to (he selection plates. /: v hem hta <oh tells containing the active \upT gene ducc blue colonics* whereas cells having the mutated \njd: gene produce white or light blue colonics Treatment of plasmids with CAA and tiansltu non tit human tells Pun lied stocks of pMY189 were prepared hy using the QlACiliN plasmid purification kit, The plasmids (40 pg) were treated with various concentrations of CAA in 0.3 M sodium acetate m total volume ol 0 5 ml, The reaction was allowed to proceed for I h at 37C followed hy ethanol precipitation ol the plasmids to remove the nonreacted excess CAA and the plasmids were rcdissolved in 0 5 ml of TE buffer (pH H) The human cells. WI38-VAI3 or XP20S (SV) were trypsini/ed. washed and suspended in Dulbecco's phosphate-buffered saline (PBS) solution (pH 7 5) Cells (2XI01) plus J4.4 pg CAA-ireated pMYI89 in PBS solution (0 2 5-GACGAATTCTGTAAAACGACGGCCAGTGAGCTCGAATTCTTG-3' 3,-CTGCTTAAGACAT^TGCTGCCGGTCACTCGAGCTTAAGAAC-5, digested by EcoRI 5'-AATTCTGTAAAACGACGGCCAGTGAGCTCG pMYl 89 Fig. 1, Construction and the structure of the shuttle vector plasmid pMY189. Two 42 mer oligonucleotides, one of them containing a sequence of -2IMI3 5'-fluorescent dye-labelled universal primer for the automatic DNA sequencing, were annealed and digested by EcoRl. and ligated into the fcoRI site of the pZI89. ml) were placed in an electroporation chamber (clectiodes tl 3 cm apart! (POS Inc Madison, Wl) and the cells were translccied with the plasmids hy electric pulses (600 V. S X), The cells were plated in live 10 cm dishes and incubated at 37"C lor 72 It in a CO* mcuhalor Ptusnud rmn'rt \rlrt /tan nj iiiulaln! \npl anti DNA W'l/lli'/u me Plasmids were extracted Irom the cells using Wi/ardIM Mmtpreps DNA Purification Systems (Promcga. Madison. Wl) I he purihed plasmids were digested with the restriction endonuclease t>pn\ (Bochringcr Yamanouchi, Tokyo. Japan) to eliminate the nonreplicaled plasmids which retain the bacterial methyialion pattern. Plasmid DNA was introduced into the indicator huctcna KS4(l/pKY24l by the electroporation apparatus E.toli Pulser (Biorad, CA). The bacterial cells were plated in LB agar containing nalidixic acid, amptcillin. chloramphenicol at concentrations of 50, 150 and 30 pg/ml respectively, supplemented with IPTG and X-gal to select (he plasmids containing the mutated supE genes. A pan of the ceils was plated on LB agar containing ampicillin and chlorampheni col to measure the total number of transformants. After 24 h incubation at 37C. colonies were counted and mutation frequencies were calculated. Mutated plasmids were extracted and purified from the overnight culture with (he Wizard Minipreps Purification System (Promcga) and the base sequences of the supF gene of the plasmids were determined with the - 21M13 primer and Dye-Primer Cycle Sequencing Reagent Kit using a 370A automatic DNA sequencer (Applied Biosystems). Results Plasmid mutagenesis 2-ChloroacetaIdehyde treatment of the pMYI89 plasmids increased the frequency of mutation in the supF gene in both repair-proficient and repair-deficient cells (Table I). The background plasmid mutation frequency was 2.2 and 1.4X 10-4 with VA13 and XP-A cells respectively. The mutation fre quency increased similarly in both cell lines following treat ment of the plasmid with CAA; and -7- and 40-fold increases with 0.13 and 0.51 M CAA respectively, were observed. Base sequence analysis Analysis of 109 supF mutant plasmids transfected to the repair proficient cells was carried out by the nucleotide sequencing. Base sequence changes in plasmids were classified as single base substitutions, tandem base substitutions, multiple base substitutions (2 = base substitutions more than three bases apart), frameshifts (single base insertions or deletions) and large deletions (Table II). Large deletions (average deleted sequence, 113 base pairs; range, 26-184 base pairs) were found in 10% of the plasmids and 14% of the plasmids contained the multiple base substitutions. The tandem base substitutions and the frameshift mutations were scarce. The rest (72%) contained the single base substitutions. Among the mutant plasmids with single base substitutions, 90% were the substitutions of G:C base pair (Table III). The most frequent type of the base substitution mutations was G:C to A:T transition (54%). Other types of the base substitutions Table l* Mutation frequency of CAA-trcated plasmids pMY189 propagated in normal or xeroderma pigmentosum fibroblasts Concentration of CAA (M) WI38-VA13 No. of colonies XP20S(SV) No. of colonies Mutant Total (X I04) Mutation frequency (X I0~4) Mutant Total (X I04) 0 0.13 0.26 0.51 85 7.1 151.3 11.9 989.0 61 7 38.0 10-2 16.7 2,2 0.2 14 9 12 59.2 37 2.3 1.9 160.7 18 3 241.0 2.3.8 154.0 4.5 1.6 12.1 77 28 Average colony numbers from three independent experiments are given with the standard error ol the mean. 2390 Mutation frequency (X It)"4) 1.4 1.2 13 3 15 31.4 z 3.1 55 3 1.6 R&S 148950 hi i i iikii o.n ii.iKHnvcn- nuiuccd inuuihons were G:C lo T:A transvcrsion (30%). G:C io C:G iransversion (6%). A;T to G.C transition (9%) and A:T u> T:A Iransversion (|A'V No single base A:T to C:G iransversion was detected. Figure 2A shows the targets of the single base substitutions jn the supF gene, compiled from the previous teports (16,17,23-39). Among the reported 93 target sites (* in Figure 2A). 54 sites arc present in G:C base pairs and 39 sites are present in A:T base pairs. The proportion of the base substitu tion at G:C base pairs is higher than that at A:T base pairs, even when the difference of the number of target sites between G:C and A:T base pairs is adjusted (Table III). Mutation spectra Distribution of the single base substitutions and tandem or multiple base substitutions in the supF gene with the repair proficient cell is also shown in Figure 2A. Eight sites (123,133,134,156,159,160,168 and 169) had four or more single base substitutions. Most of the single base substitutions (91%) were produced at these hotspots. Seven of the eight hotspots were located at G:C base pairs. Five G:C to A:T or G:C to T:A hotspots (123,159,160,168 and 169) are located at G:C base pairs in 5'-AAGG-3' sequences. All multiple base substitutions were found in separate positions, except one tandem base substitution (Figure 2B). There are 15 two-base substitutions and one three-base substi tutions. Discussion Plasmids pMY189 treated with CAA yielded the same fre quency of mutations when they were propagated in XP-A and normal cells, suggesting that the DNA damage induced by CAA is not repaired by the nucleotide excision repair pathway in human cells. This was supported by the preliminary experi- TSble II, Types of mutations in the supF gene in CAA-treated shuttle vector plasmids pMY!89 propagated in human fibroblast cells WI38-VAI3 Type of muialion No. Percentage of total Base substitution Single base substitution Tandem base substitution Multiple bast substitution Frameshift Single base insertion Single base deletion Deletion over 3 base pair Others Total 78 1 15 0 1 12 2 109 71.6 0.9 13.8 0.0 0.9 10.1 1.8 100 Table III, Types of CAA-induced single base substitutions in the supF gene in shuttle vector plasmids pMYI89 propagated in human fibroblast cells WI38-VA13 Type of mutation No. (%) of mutants No. of mutants/iargct sneJ {%) G.C to A T G:C to T:A G.C to C:G A T to G:C A:T to T:A A T to C:G Toial 42 (53 8) 23 (29.5) 5 (6.4) 7 (9.0) 1 (1.4) 0 (0.0) 7X (100) 0 778 (51.8) 0.426 (28.4) 0.093 (6.2) 0.179 (11.9) 0 026(1.7) 0 (0.0) 1 502(100) "Numbers ol targets ol the single base substitution mutations m the suplgene are 54 ai G C pairs and 39 ai A T pans ment indicating that the survival of (he CAA-treated pMYI89 plasmids introduced in F.coli MBM7070 (wild type) and KY46 (uvrA) were the same (data not shown). CAA-induced DNA adducts were reported to be repaired by a human 3-mcthyladenme DNA glycosyla.se (40,41), sug gesting that DNA repair other than the nucleotide excision type may be involved. In mutation spectra of the single base substitutions, 72 out of 78 (92%) were located in the eight mutational hotspots among 93 mutation target sites in the supF gene. There arc four 5'-AAGG-3' or 5'-CCTT-3' sequences in the supF gene (positions 68-71, 120-123, 157-160 and 168-171). Fiftyseven out of 78 (73%) single base, substitutions were located at G:C pairs in these 5'-AAGG-3' or 5'-CCTT-3' sequences. This suggests that G:C pairs in the 5'-AAGG-3' or 5'-CCTT3' sequences are the major mutational targets by CAA. The sequence 5'-AAGG-3' on position 68-71 was not mutated. However, no mutation at position 70 and only two mutations at position 71 have been reported previously, suggesting that these sites are phenotypically silent or may be protected from attack by the chemical caused by the secondary structure of the gene. The possibility that we isolated sibling mutants is unlikely, because we took 109 colonies out of about 3000 mutant colonies and no identical mutation was found in the tandem and multiple base substitutions, frameshifts and dele tion mutations. We do not know why such a high sequence specificity is achieved. DNA damage may be induced or DNA repair may be blocked selectively on this sequence by unknown mechanisms. G:C to A:T transition mutations are predominant (53.8%), supporting the previous findings that chloroethylene oxidetreated E.coli (15) and CAA-treated gapped duplex M13 DNA (13) had mainly G:C to A:T transitions. The adducts which can cause mutations in G.C base pairs could be the 3JY* ethenocytosine (eC) and the A/^-ethenoguanine (N2,3-eG). The tfi.'h-zG-T mismatch caused G:C to A:T transitions in an in vitro DNA replication experiment (8). Site specifically incorporated N2,3-eG in the Ml3 double strand DNA resulted in G to A transitions (11) and site specifically incorporated C in the M13 single strand DNA (9) or gapped duplex DNA (10,12) led mainly to C to T transitions. These reports and our experiment suggest that the major contributors to the G:C to A:T transitions induced by CAA in human cells are C and A/2,3-eG. The previously published data of the mutations in G:C base pairs induced by CAA or its related cyclic adducts are summarized in Table IV. Compared with other studies using M13 phage, our results show relatively high frequency of G:C to T:A transversion mutations. It may reflect the different mechanisms of the DNA repair or the mutation fixation in E.coli and human cells, since the similar difference was observed in UV-induced mutations in M13 and human cells (33.42). The published data of the mutations in A:T base pairs induced by CAA or its related cyclic adducts are summarized in Table V. The predominance of A:T to G.C transition mutations in our data supported the previous findings that site-specifically incorporated A and 4-amino-5-(imidazole-2yDimidazole (P) in single strand M13 DNA induced mainly A.T to G:C transitions (9) in E.coli. The data of mutations in the CAA-treated M13 gapped duplex DNA replicated in E.coli, however, showed (he predominance of A.T to T: A transversions (13). In addition to the difference in the mechanism of the R&S 148953 2391 T.Mateuda el al. *.*tTCfcTi1CfctCCCCtCCCtttCctcmiCCCfcCCi6CCCiCT4iiACCfcTT*CCT5TCCt6C6C1KCCCl6C<CCC4AACCCi.CCAUCTCtlA4TCTCCCCtCltCt*.CTTCCAACCnCCA<.TCCTTCCCCCiCCfcCC*TCitTT1C>ii4ClCCt ic to 70 to so too no 120 iso uo no no no too no 200 A. CG C AA A A A A A A A A A A A AC AC AC cAcC CA C A AA A AA A AA A AA AA AT AT AT AT A A AA AA AA TA T AmCiTATCATCCCCCCCGCTTCCCCATAACOCACCACCCCACTUUOClTTACCrCTCCTCCCCmcCCiCCCCCCAAiCCCACCACACTCTAAATCtCCCIiTCATCCACTTCCAACCTTCCAATCCTTCCCCCiCCACCitaCTTTCiUACTCCC 40 SO 80 70 to 90 100 110 llO ISO 140 I SO 100 170 t80 190 S00 ... T B. 40 SO Fig. 2. Locations of the single (A) and tandem and multiple (B) base substitution mutations found in the supF suppressor tRNA gene in CAA-treated plasmids pMY189 propagated in WI38-VA13 cells. Each letter under the sequence represents a single base substitution mutation found in an independent plasmid (A). Multiple base substitutions are shown in (B). Positions of the targets of the single base substitutions which inactivate the suppressor function are as follows [Position (Ref.)]: 42(16), 43(16,39). 45(16). 46(16), 50(16. 38), 53(28). 59(39). 62(39), 63(16), 65(16,24,26), 71(16,26). 77(16,31). 80(24). 93(24,26), 99(24.26,34), 100(16), 102(16,17,25), 103(16.17,37). 104(16,17,33,37), 105(16,17,37.33,38), 106(16,34.38), 107(37), 108(16,23,26,31.36-39), 109(16,17,24-26,29.31,33,34,37). 100(16.25,30.31,36). 111(16,23.26.30.37), 112(16.17,29,30,33,34,37.38), 113(16,17.23,25.26.31,34,37,38), 114(16,26). 115(16.17,25,29,37,38), 116(16.17,25,26,29,31), 117(16.36), 118(16,24.34), 119(16.34), 120(16.24,31,33-35,37.38), 121(27,37). 122(16,25,31,34.36,37), 123(16,17,23-26,32-34,37-39), 124(16.17,24.33,34,36,38,39), 125(16.37), 126(16,37), 127(16,17.25,29,33.34,37,38), 128(30), 129(16,17,24-26,31.32,34,35). 130(37). 132(16.34.37), 133(16,17.24-27.29,31-34,38). 134(16,27,31,33,34,37-39). 135(16,27,31,33-35,38,39), 136(16,17,24.26,27,29,31,33-37,39), 137(16,17,31,3334), 138(37), 139(16.17,24-26,29.33-35.37,38), 140(16,24,25,3034). 141(16.2533.34.37,38). 143(16,25), 144(16,17.24,26.29.3334,37).145(37), 147(35), 148(Akasaka er o/., in press), 149(26,33,35), 150(16,31,37), 151(37), 153(37,39). 154(16.31,3537), 155(16,17.23,25.26,29.31-37.39), 156(16.17,23-26,31-39), 157(37), 158(16,31,34.37), 159(16.17,23-26,2931-39), 160(16.17,23-27,2930.31.33,34.38). 161(16,27,33,34,37). 162(16,25,27.34,36,37). 163(16.31,32.37), 164(16,17,24-26,29.31,33.34,36,37,39), 165(16,25,31.33,34,36,37), 166(27.37), 167(16,37), 168(16,17,23-27, 29-39), 169(16,17,23-26.29-31,33-39), 170(37), 171(16,34.37,39), 172(16,17.24-26,29.33,34,37,38), 173(16,34,39), 174(16,17,25,37), 175(16,31.33,37), 176(17). 177(16.17,34,35), 178(17,25), 179(16,34), 180(37), 200(16). Table IV. Types of G:C base substitution mutations induced by 2-chIoroacetaldehyde and its related cyclic adducts No. (%) of mutants Type of mutation eG* MI3 dsDNA in Exoli eCb MI3 ssDNA in Exoli eC* MI3 gdDNA in Exoli CAA treated1* MI3 gdDNA in Exoli Our data' G:C to A:T G:C to T:A G:C to C:G 1 base deletion Total 134 (99.3) 0(0) 1 (0.7) 0(0) 135 (100%) 31 (56.4) 12 (21.8) 0(0) 12 (21.8) 55 (100%) (64.0) (10.9) (0) (25.0) (100%) 80(72.1) 20 (18.0) 11 (9.9) 0(0) 111 (100%) 63 (64.9) 29 (29.9) 5 (5.2) 0(0) 97(100%) *Site-specifically incorporated 6/*,3-ethenoguanine (5'-GG(G)AAA-3') in double strand MI3DNA was replicated in Exoli cells (II). bSite-specifically incorporated 3.Af*-ethenocytosine (5'-TAG(eC)GGG-3') in single strand MI3DNA was replicated in Exoli cells (9). 'Sile-specifically incorporated 32V4-ethenocytosine (5'-TT(C)TT-3`) in gapped duplex MI3DNA was replicated in Exoli cells (10). Mutation was analyzed by the multiplex sequence analysis. dT7'e CAA treated gapped duplex MI3DNA was replicated in UV-irradiated Exoli cells (13). 'Data contain all single, tandem and multiple base substitutions 2392 R&S148952 'fable V. Typo ol A T hasc subsinulmn tmiuilions induced by 2( h It >|< i.uri.i I| It'llydc (C'AA) and ns ici.iud cyclic adducis Type ol nuii-uinn Nn, j ol imii.mis tA-4 MM nvDNA nt /, nth |lh MH ssDNA in /. r ah CAA irciited4 Our dala*1 MM jhJDNA m /: (ah A.T to G.C A T lo T A A T io C G Total 17 (56.7) 5 (16.7) 8 (26.7) 30 (l(K)9H II (68 8) 2 (12.5) 3 (18.8) 16 (10091) 4 (17,4) IX (78 3! 1 (4,3) 23 (10091-) 10(769) 2(15.4) 1 (7.7) 13 (10091') 'Site-spccilically incorporated UVA-ethcnoademne (5'-GCT(A)GC-3') in single strand MI3DNA was replicated in E.coli cells (V). ''Sile-specdically incorporated 4-amino ,*i-(imid.i/i)l 2-yI)mnda/olc (p) |5'GCT(P)GC-.V| in single strand MI3DNA was replicated in E.cah cells (9). 'The CAA treated gapped duplex MI3DNA was replicated in (JV-irradiated E.coli cells (13). ^Daia contain all single, tandem and multiple base substitutions. mutation fixation in E.coli and human cells, the contradicting results with M13 may be due to the difference in the sites of the adducts produced in DNA as the adducts are located in the single stranded region of the gap in the gapped duplex DNA (13). The shuttle vector plasmid pMY189 designed to be applied to the fluorescent dye primer cycle sequencing by an automatic DNA sequencer, made the analysis of the nucleotide sequences of the mutant supFgenes easier and faster than the conventional radioisotope labelling and autoradiography method. This method also made the analysis more accurate than the dye deoxy terminator cycle sequencing method using the automatic DNA sequencer we previously used (33). In conclusion, we found that about half of the CAA-induced mutations were G.C to A:T transitions and that most of the remaining mutations were G:C to T:A transversions and A:T to G:C transitions in the shuttle vector plasmid pMYI89 propagated in human cells. G:C pairs in 5'-AAGG-3' or 5'CCTT-3' sequences are the major target of mutations, mainly, G:C to A:T transitions. This sequence specificity can be extrapolated to the estimation of contribution of VC to carcino genesis in human beings. References 1.tARC (1987) IARC Monographs. International Agency for Research on Cancer. France, Supplement 7. pp. 373-376. 2. IARC (1987) IARC Monographs. International Agency for Research on Cancer, France. Supplement 6, pp. 566-569. 3.Laib,R.J.. Gwinner.L.M, and Bolt.H.M. (1981) DNA alkylation by vinyl chloride metabolites: Elheno derivatives or 7-alkylation of guanine? C/iem.Bial. Interactions. 37, 219-231. 4.Leonard.N-J. (1984) Etheno-substituted nucleotides and coenzymes: Fluorescence and biological activity. CRC Crii. Rev Biaihem . 15. 125-- 136 5.Barbin.A. and Bartsch.H. (1986) Mutagenic and promutagenic properties of DNA adducts formed by vinyl chloride metabolites. In Singer.B. and Bartsch.H. (cds) The Role nfCvt lie Nucleie Acid Adducis in Carcinogenesis anil Mutagenesis IARC Scientific Publication, Oxford University Press. London pp. 345-358. 6. Fcdlkc.N., Walker,V.E. and Swenbcrg.J.A (1989) Determination of 7-(2-oxoethyl) guanine and /V-.3-ethenoguaninc in DNA hydrolysates by HPLC. Arch Toxical. Suppl. 13. 214-218 7 Hall.J.A.. Satihill.R,. Green.T and Hathway.D.E. (1981) The induction ol errors during in rum DNA synthesis following chloroaceialdehydetreattnent ol poly(dA-dT) and poly(dC dG) tempi,lies Cairinngcntsn. 2. 141-146. Analysis of 2-<.hl<iroac(aldchydc induced mutations X Singcr.ll,. Kusmierck.J.'I , lolkman.W, Cliavcz,Z, and Dosanijh.M K 11991) Evidence lor lire mutagenic potential of the vinyl chloride induced adduct. N~,Vcihcno-dciixygujnosinc, using a sue-dtrecled kinetic assay Cart magrarsis. 12. 74S-747 9 Hasu.A.K , Wood.M.I.. Nicdernholcr.I.J., Ramos.L,A. and Essigmami.J M (1993) Mutagenic and gcnotoxic effects of three vinyl chloridc-induccd DNA lesions. I .M'-cihenoadcnine, 3.Ar'-eibenocyt<>Mnc anil 4-ammo-5-(tmida/u!-2-y!) nmda/ule. Biachemislry,32. 12 793-12 801 It). Palcjwala.V A.. K/,cpka.R.W. Snnha.D. and Humayun.M.Z. (1993) Quantitative multiplex sequence analysis of mutational hot spots Frequency and specificity ol mutations induced by a sile-speciHc cthcnocytosinc in MI3 viral DNA Biochemistry. 32, 4105-4111, 11 Chcng.K.C, Preston.B.D,, Cahill.D.S.. Dosanjh.M.K., Singer.B. and Loeb.L.A. (1991) The vinyl chloride DNA derivative (VJ,3-elhenoguanine produces G--tA transitions m Escherichia coii. Proc. Natl Acad. Sci. USA, 88. 9974-9978. 12. Palejwala.V.A , Simha.D. and Humayun.M.Z. (1991) Mechanisms of mutagenesis by exocyclic DNA adducts. Transfection of M13 viral DNA bearing a site-specific adduct shows that ethenocytosine is a highly efficient recA-independent mutagenic nomnsiructional lesion. Biochemistry, 30. 8736-8743. 13. JacobsenJ.S. and Humayun.M.Z. (1990) Mechanisms of mutagenesis by the vinyl chloride metabolite chloroacetaldehyde. Effect of gene-targeted in vitro adduction of MI3 DNA on DNA template activity in vivo and in vitro. Biochemistry, 29, 496-504. 14. Marion,M.J., Froment.O. and Trepo.C, (1991) Activation of Ki-ras gene by point mutation in human liver angiosarcoma associated with vinyl chloride exposure. Mol. Carcinogenesis. A. 450-454. I S.Barbin.A., Besson.F., Perrard.M.H.. BereziatJ.C., KaldorJ,, Michel.G. and Bretsch.H. (1985) Induction of specific base-pair substitutions in .coli trpA mutants by chloroethylene oxide, a carcinogenic vinyl chloride metabolite. Mutat. Res.. 152. 147-156. 16. Kraemer.K.H. and Scidman.M.M. (1989) Use of supF, an Escherichia coii tyrosine suppressor (RNA gene, as a mutagenic target in shuttle-vector plasmids. Mutat. Res., 220, 61-72. 17. Levy,D.D., GroopmanJ.D.. Lim.S.E., Scidman.M.M. and Kraemer.K.H. (1992) Sequence specificity of afiatoxin Brinduccd mutations in a plasmid replicated in xeroderma pigmentosum and DNA repair proficient human cells. Cancer Res.. 52, 5668-5673. 15. Moriwaki.S.. Yagi.T., Nishigori.C, lmamura,S. and Takebe,H. (1991) Analysis of ATmethyl-N-nitrosourea-induced mutations in a shuttle vector plasmid propagated in mouse O^-methylguanine-DNA methyltransferasedeficient cells in comparison with proficient cells. Cancer Res., 51, 6219-6223. 19. Akasaka.S., Takimoto.K. and Yamamoto.K. (1992) G.C --T,A and G.C --* C.G transversions are the predominant spontaneous mutations in the Escherichia coii supF gene: an improved lacZ(am) E.coli host designed for assaying pZI89 supF mutational specificity. Mol. Gen, Genet., 235. 173-178. 20. Girardi.A.J.. Jensen.F.C and Koprowski.H. (1965) SV40-induced transformation of human diploid cells, crisis and recovery. J. Cell. Comp. Physiol.. 65. 69-84. 21. Takebe,H.. Nii.S.. Ishii.M. and Utsumi.H. (1974) Comparative studies of host-cell reactivation, colony forming ability and excision repair after UV irradiation of xeroderma pigmentosum, normal human and some other mammalian cells. Mutat. Res.. 25, 383-390. 22.Seidman.M.M.. Dixon.K.. Razzaque.A., Zagursky.R. and Berman,M.L. (1985) A shuttle vector plasmid for studying carcinogen-induced point mutations in mammalian cells. Gene. 38, 233-237. 23. Brash.D.E., Secthaiam.S., Kraemer.K.H., Scidman.M.M. and Bredberg.A. (1987) Pholoproducl frequency is not the major determinant of UV base substitution hot spots or cold spots in human cells. Proc. Natl Acad. Sci USA. 84. 3782-3786. 24. Moraes,E.C., Keysc.S.M., Pidoux.M. and Tyrrell,R.M. (1989) The spectrum of mutations generated by passage of a hydrogen peroxide damaged shuttle vector plasmid through a mammalian host. Nucleic Acids Res.. 17. 8301-8312. 25-Bigger.C.A.H.. Flickinger.DJ.. SirandbergJ.. PatakiJ.. Harvey.R.G. and Dipple.A. (1990) Mutational specificity of the ami 1,2-dihydrodiol 3,4epoxide of 5-methylchrysenc. Carcinogenesis. 11. 2263-2265. 26. Moraes.E.C.. Keysc.S.M. and Tyrrell,R.M. (1990) Mutagenesis by hydrogen peroxide treatment ol mammalian cells, a molecular analysis. Carcinogenesis. II. 283-293. 27, Wang,R. Bennett.R.A O. and Povirk.L.F. (1990) Melphalan-induced mutagenesis in an SV40-based shuttle vector. Predominance of A.T -- R&S148953 2393 T.Matsuda (t at. . T.A transvcrsions ( nn< rr Hr*. . SO. 7327 737 I 28. Akman.S.A.. Forrest.C P.. Doroshow.J.H and Dizdaroglu.M. (1991) Mutation of potassium permanganate- and hydrogen peroxide-treated plasmid pZI89 replicating in CV-1 monkey kidney cells Muiat. Rc\ . 261, 123-130. 29. Bigger,C,A.H., Flickinger.D.J., JohnJ.S.. Harvey.R G. and Dipple.A (1991) Preferential mutagenesis at G,C base pairs by the anti 3,4dihydrodiol 1,2-epoxide of the 7-methylbenz|a|anthracenc, Mol Curemogenesi.\, 4, 176-179. 30. Bubley.GJ., Ashbumer.B.P. and Teicher.B.A. (1991) Spectrum of 11\ diammmedichloroplalinum(II)-induced mutations in a shuttle vector propagated in human cells. Mol. Carcinogenesis, 4, 397--406. 3I.Seelharam.S.. Kraemer.K.H.. Waters.H.L. and Seidman.M.M. (1991) Ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum lymphoblastoid cells and fibroblasts Muiat. Res.. 254, 97-105. 32.Seetharam,S. and Seidman.M.M. (1991) Modulation of an ultraviolet mutational hotspot in a shuttle vector in xeroderma cells. Nucleic Acids Res.. 19. 1601-1604. 33. Yagi.T., Tatsumi-MiyajimaJ,, Sato.M.. Kraemer.K.H. and Takebe.H. (1991) Analysis of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in cells from Japanese xeroderma pigmentosum patients in complementation groups A and F. Cancer Res.. 51, 3177-3182. 34. Bigger.C.A.H., JohnJ.S.. Yagi.H., Jerina.D.M. and Dipple.A. (1992) Mutagenic specificities of four siereoisomenc benzo[c]phenanthrenc dihydrodiol epoxides. Proc. Natl Acad. Sci. USA, 89, 368-372. 35. Yagi.T., Sato.M., Tatsumi-MiyajimaJ. and Takebe.H. (1992) UV-induced base substitution mutations in a shuttle vector plasmid propagated in group C xeroderma pigmentosum cells. Muiat. Res., 273, 213-220. 36. Madzak.C.. ArmierJ,, Stary.A., Daya-Grosjean.L. and Sarasin.A, (1993) UV-induced mutations in a shuttle vector replicated in repair deficient trichothiodystrophy cells differ with those in genetically-related cancer prone xeroderma pigmentosum. Carcinogenesis, 14, 1255-1260. 37. Routledge,M.N., Wink.D.A., Keefer.L.K. and Dipple,A. (1993) Mutations induced by saturated aqueous nitric oxide in the pSP189 supF gene in human Ad293 and E.coli MBM7070 cells. Carcinogenesis, 14, 1251-1254. 38. Akasaka.S. and Yamamoto.K. (1994) Hydrogen peroxide induces G:C to C:G transversions in the supF gene of Escherichia colL Mol. Cen. Genet., 243. 500-505. 39. Yagi.T., Sato.M., Nishigori.C. and Takebe.H. (1994) Similarity in the molecular profile of mutations induced by UV light in shuttle vector plasmids propagated in mouse and human cells. Mutagenesis, 9, 73-77. 40. Dosanjh.M.K., Chenna.A., Kim.E.. Fraenkel-Conrat.H., Samson.L. and Singer.B. (1994) All four known cyclic adducts formed in DNA by the vinyl chloride metabolite chloroacetaldehyde are released by a human DNA glycosylase. Proc. Natl Acad. Sci. USA, 91, 1024--1028. 41. Dosanijh.M.K.. Roy.R.. Mitra.S. and Singer.B. (1994) 1 JV^Ethenoadenme is preferred over 3-methyladenine as substrate by a cloned human W-mcthylpurine-DNA glycosylase (3-methyladenine-DNA glycosylase). Biochemistry, 33, 1624--1628. 42. Wood.R.D., Scopck.T.R. and Hutchinson,F. (1984) Changes in DNA base sequence induced by targeted mutagenesis of lambda phage by ultraviolet light. J. Mol. Biol., 173. 273-291. Received on February 9, I99S: revised on June 26. 1995: accepted on July IS, 1995