Document QXQaevXD1ydvg6g18ZLavLYR6

Published Ahead of Print on February 28, 2011, as doi:10.3324/haematol.2010.031179. Copyright 2011 Ferrata Storti Foundation. Early Release Paper Upregulation of homeodomain genes, DLX1/2, by FLT3 signaling by Julia Starkova, Sharvari Gadgil, Yi Hua Qiu, Nianxiang Zhang, Ivana Hermanova, Steven M. Kornblau, and Harry A. Drabkin Haematologica 2010 [Epub ahead of print] Citation: Starkova J, Gadgil S, Qiu YH, Zhang N, Hermanova I, Kornblau SM, and Drabkin HA. Upregulation of homedomain genes, DLX1/2, by FLT3 signaling. Haematologica. 2010; 95:xxx doi:10.3324/haematol.2010.031179 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process. Haematologica (pISSN: 0390-6078, eISSN: 1592-8721, NLM ID: 0417435, www.haematologica.org) publishes peer-reviewed papers across all areas of experimental and clinical hematology. The journal is owned by the Ferrata Storti Foundation, a non-profit organization, and serves the scientific community with strict adherence to the principles of open access publishing (www.doaj.org). In addition, the journal makes every paper published immediately available in PubMed Central (PMC), the US National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature. Support Haematologica and Open Access Publishing by becoming a member of the European Hematology Association (EHA) and enjoying the benefits of this membership, which include free participation in the online CME program Official Organ of the European Hematology Association Published by the Ferrata Storti Foundation, Pavia, Italy www.haematologica.org DOI: 10.3324/haematol.2010.031179 Upregulation of homeodomain genes, DLX1/2, by FLT3 signaling Running title: FLT3, DLX1/2 and TGF interaction Julia Starkova1,3, Sharvari Gadgil2, Yi Hua Qiu4, Nianxiang Zhang4, Ivana Hermanova3, Steven M. Kornblau4 and Harry A. Drabkin1 1Division of Hematology-Oncology, Medical University of South Carolina, Charleston, SC, USA; 2Division of Medical Oncology, University of Colorado Health Sciences Center, Aurora, CO, USA; 3Department of Paediatric Haematology/Oncology, 2nd Faculty of Medicine, Charles University Prague, Czech Republic 4Department of Stem Cell Transplantation and Cellular Therapy, Section of Molecular Hematology and Therapy, The University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA Correspondence Julia Starkova, PhD, CLIP- Childhood Leukemia Investigation Prague, 2nd Faculty of Medicine, Charles University in Prague, V uvalu 84, Prague 15006, Czech Republic, Phone: international +420.224436580. Fax: international +420.224436521. E-mail: julia.starkova@lfmotol.cuni.cz Key words: acute myeloid leukemia, FLT3, DLX1, DLX2, TGF 1 DOI: 10.3324/haematol.2010.031179 Abstract Background. Activating mutations in FLT3 are frequent in acute myeloid leukemia and represent both a poor prognostic feature and therapeutic target. We have identified a previously unrecognized downstream effect of FLT3 activation, namely upregulation of the homeodomain genes, DLX1 and DLX2. Design and Methods. MV4;11 cells with FLT3/ITD mutation, RS4;11 cells with wildtype FLT3 and AML patient blasts were used to pursue the relation between FLT3, DLX1/2 and TGF. Quantitative RT-PCR, Western blot and reverse-phase protein array were performed to detect changes in gene and protein expression. RNA interference and MTS assay studied the interaction of PKC412, FLT3 inhibitor and TGF1. Results. A direct relationship between FLT3 activity and DLX1/2 expression was revealed by both inhibition and upregulation of FLT3 signaling in MV4;11 and RS4;11 cell lines, respectively, in isolated blast cells from patients with acute myeloid leukemia, and in reverse-phase protein array from patient samples with acute myeloid leukemia. Mechanistically, the link between FLT3 and DLX1 expression appears to involve MAPK signaling through the ERK and JNK pathways. To determine whether elevated DLX1 had a functional consequence, we explored the reported inhibition by DLX1 on TGF/Smad signaling. Indeed, TGF responses were blunted by FLT3 activation in a DLX1-dependent manner and FLT3 inhibition resulted in a time-dependent increase in nuclear phospho-Smad2. Conclusions. These findings suggest that alterations in DLX1/2 contribute to the biologic consequences of FLT3 activation. 2 DOI: 10.3324/haematol.2010.031179 Introduction Homeodomain genes encode transcription factors that affect pattern formation, differentiation and proliferation during development. In humans, four clusters of homeodomain genes are distributed on chromosomes 7p15 (HOXA), 17q21 (HOXB), 12q13 (HOXC) and 2q31 (HOXD). Nonclustered homeodomain genes are distributed throughout the genome (1). For simplicity, all homeodomain-containing genes, clustered and nonclustered, will hereafter be referred to as HOX. HOX deregulation is involved in the development of leukemia, as evidenced by recurrent chromosomal translocations that fuse the nucleoporin gene, NUP98, with HOXA9, HOXA11, HOXA13, PMX1, HOXC11, HOXC13, HOXD11 or HOXD13 (25). Rearrangements of MLL, which normally functions to maintain proper HOX levels (6), result in overexpression of HOXA9 and MEIS1 (7). In addition, overexpression of other HOX genes such as HOXA5 (8), HOXB3 (9) and HOXB4 (10, 11) have been shown to affect myeloid proliferation and differentiation, suggesting that their deregulation may contribute to the leukemogenic process or phenotype. Other examples of Hox involvement include murine BXH-2 leukemia, where HoxA7 and HoxA9 are frequent targets of retroviral integration (12), and are necessary for the development of leukemia in mice carrying a MLL-ENL rearrangement (13, 14). We previously reported that HOX expression patterns correlated with major cytogenetic subtypes in human acute myeloid leukemia (AML) (15) and that AMLs with the highest levels of HOX expression represented a subset of intermediate cytogenetic cases with elevated levels of FLT3 (fms-like tyrosine kinase-3), a higher rate of FLT3 mutations, and a lower incidence of CEBP mutations (16). More recently, we identified a common HOX expression signature in favorable AMLs (17), which may influence their biologic behavior. FLT3 is a tyrosine kinase expressed in early hematopoiesis (18). The FLT3 pathway affects proliferation, differentiation and apoptosis of hematopoietic cells. FLT3 signaling leads to activation of RAS, STAT5 and PI3K (19, 20). It is constitutively activated in about 30% of AMLs (21) and the FLT3/ITD (internal tandem duplication) mutation is predictive of increased relapse rates and higher mortality (22-24). The 3 DOI: 10.3324/haematol.2010.031179 association between FLT3 mutations and certain patterns of HOX expression prompted us to ask whether there is a direct connection between FLT3 signaling and any particular HOX gene. As described here, we identified a novel interaction between FLT3 activity and regulation of the homeodomain transcription factors, DLX1 and DLX2, at both the mRNA and protein levels. The DLX genes are part of the Drosophila distal-less family that play a role in the control of craniofacial patterning and the differentiation and survival of inhibitory neurons in the forebrain (25). Moreover, the resulting changes in DLX1 expression appear to be functionally significant, as evidenced by effects on TGF signaling pathway. Design and methods Cell lines and reagents We used the following cell lines obtained from ATCC (American Type Culture Collection, VA, USA): MV4;11, derived from an acute monocytic leukemia with a FLT3/ITD mutation and RS4;11, an acute lymphoid leukemia with wild-type FLT3 . We verified the cell lines by polymorphic microsatellite genome profiling (not shown). We performed in vitro treatments with the following agents: PKC412 (Novartis, Switzerland), imatinib mesylate (Novartis, Switzerland), staurosporine (Sigma, St. Louis, MO, USA), human recombinant TGF1, human recombinant FLT ligand (R&D Biosystems, Minneapolis, MN, USA), U0126, SP600125, SB203580 and LY294002 (Sigma, St. Louis, MO). Antibodies used for Western blot were: DLX1 monoclonal (M01, clone 2H3; Abnova), -actin monoclonal (Sigma, St. Louis, MO), phospho-FLT3 (Tyr 591, Cell Signaling, Danvers, MA), CREB-1 monoclonal (X-12; Santa Cruz), GAPDH monoclonal (Ambion), phospho-Smad2 polyclonal (Ser465/467), Smad2 monoclonal (L16D3) (Cell Signaling, Danvers, MA, USA). 4 DOI: 10.3324/haematol.2010.031179 Treatment of leukemic cell lines with different compounds To measure expression of HOX and TGF1 target genes, MV4;11 and RS4;11 cells (5x105 cells per ml) were treated 2, 5 and 24 hours with PKC412 (0.1 M), TGF1 (1, 2, 3, or 5 ng/ml), FLT ligand (100 ng/ml), or with the following kinase inhibitors as described in the text: U0126 (MEK1/2 inhibitor, SP600125 (JNK inhibitor), LY294002 (PI3K inhibitor) and SB203580 (p38 inhibitor), all at 10M. Cells were seeded in in 6well plates containing RPMI 1640 (HyClone, UT), 10% FCS (HyClone, UT), 100 U/ml penicillin/streptomycin (HyClone, UT) 24 hours before the drug was added. Cells were harvested by centrifugation and washed with PBS (HyClone, UT) prior to preparation of protein lysates and RNA using standard methods. All experiments were performed in independent triplicates. To measure changes in phospho-Smad2, cells were first incubated in serum-free RPMI 1640 medium for 7 hours. PKC412 (0.1 M) was added for 5 hours (to achieve a decrease in DLX1), and cells were then incubated with two different low concentrations of TGF1 (1.2 and 0.6 ng/ml) for 2 hours. Control samples were treated with TGF1 only (in serum-free media). Patient samples Eighteen RNA samples from AML patients at diagnosis were used for DLX1 analysis. Patients were divided into two groups according FLT3 mutation. FLT3/ITD mutation was detected by PCR amplification and DNA agarose gel electrophoresis. Difference in blast count of diagnostic samples did not correlate with DLX1 expression. 576 samples from patients with AML were analysed by RPPA method. All experiments were conducted according to the principles expressed in the Declaration of Helsinki. Ethical committee and Institutional review board approved the project and all samples were analyzed with written informed consent of subjects or their guardians. 5 DOI: 10.3324/haematol.2010.031179 Treatment of patient sample ex vivo with PKC412 AML blast cells isolated from patient samples containing a FLT3/ITD mutation (n=3) or FLT3 wild type (n=1) were incubated ex vivo in RPMI 1640, 10% FBS enriched with a cytokine cocktail (10 ug/ml FLT3, 10 ug/ml IL-6 and 10 ug/ml SCF-1) for 24 hours, then PKC412 was added and the cells incubated another 24 hours prior to harvest. Quantitative real-time PCR Total RNA was isolated with RNeasy Plus mini kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer instructions. Intact RNA was verified by 1% agarose gel electrophoresis and cDNA was prepared using RT SuperScript III (Invitrogen, Carlsbad, CA,USA) and random-hexamer priming. Gene expression was measured on an ABI 7500 Fast real-time PCR machine using a 2X Power SybrGreen PCR Master kit (ABI, Foster City, CA, USA). The panel of HOX genes has been previously described and the assays validated (17). All genes were analyzed in the same PCR conditions, i.e., 95C x 10 min. followed by 35 cycles of: 95C x 15s then 60C x 1 min. Primer sequences of the genes utilized are provided in the supplementary material (Table S3). Raw data were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), that is, Ct = Ctspecific gene -Ct GAPDH. Expression data are reported as the number of transcripts per thousand copies of GAPDH. Western blotting, nuclear and cytoplasmic fraction Cells for protein extraction were washed with PBS and the cell pellets kept at - 80C before use. Whole-cell protein lysates were prepared in 50 mM Tris-HCl pH 7.5, 150 mM sodium chloride, 0.5% NP-40, 1 mM DTT, 2 mM MgCl2 together with 1 mM sodium fluoride, 1 mM PMSF, 1 mM orthosodium vanadate, 10 g/ml pepstatin A, 10 g/ml aprotinin and 10 g/ml leupeptin, followed by sonication for 15s and centrifugation for 4000 rpm/5 min. Protein concentrations were measured by the Bradford assay using a plate reader Synergy 2 (BioTek Instruments, VT). Expression of DLX1, phospho-FLT3 (Tyr 591) and Smad2 was measured in whole lysates. -actin was used as a loading control. 6 DOI: 10.3324/haematol.2010.031179 NePer kit (Pierce, Rockford, IL, USA) was used according manufacturer instructions for nuclear-cytoplasmic fractionations. Protein concentration of nuclear and cytoplasmic extracts was adjusted to the same ratio. Phospho-Smad2 was measured in both fractions; CREB-1 was used as a loading control for the nuclear fractions and GAPDH for the cytoplasmic fractions. Cell cycle analysis DNA analysis was performed using BD FACSCalibur cytometer. Cells were washed in PBS and digested with 0.3% saponin, 50 g/ml PI (Sigma, St. Louis, MO), 0.1 mM EDTA, RNase A (Sigma, St. Louis, MO) in 1x DPBS (HyClone, UT) and left overnight at 4C in the dark before analysis. Transfection and RNA interference MV4;11 and RS4;11 cells were transfected by electroporation using an EPI2500 instrument (Dr. L. Fischer, Heidelberg, Germany) and 0.4 cm gap Gene Pulser/MicroPulser Cuvettes (Bio-Rad, Hercules, CA, USA) under the following conditions: 1 million cells/100l of culture medium, 500 nM siRNA, and 1 pulse of 15ms, 250V and 1200F. The siRNA transfection efficiency was monitored by flow cytometry. DLX1 targeting ON-TARGETplus SMARTpool (siDLX1) was used for the DLX1 knock-down in MV4;11 and RS4;11 cells with ON-TARGETplus Non-targeting Pool (sinonT; Dharmacon) as a negative control. MTS assay MTS is a colorimetric mitochondrial-based cell proliferation assay based on measurement of soluble formazan, which is proportional to the number of live cells. MV4;11 cells were seeded at 8x103 cells per well 24 hours before treatment containing either PKC412 (i.e., 25, 12.5, 6.25 nM), TGF1 (i.e., 0.3125, 0.625, 1.25 ng/ml), or the combination. After 96 hours, 14 l of MTS reagent (Promega, Madison, WI) was added to cells and incubated for 3 hours. Absorbance at 490 nm was measured in a Synergy 2 plate-reader (BioTek Instruments, VT, USA). 7 DOI: 10.3324/haematol.2010.031179 RPPA analysis RPPA allows measurement of protein expression levels in a large number of biological samples simultaneously in a quantitative manner (26). A RPPA dataset (576 samples printed in replicate with 5 serial 1:2 dilutions in 48 rows and 144 columns) was generated by using blood or marrow samples from patients with AML. Samples had been acquired during routine diagnostic assessments in accordance with the regulations and protocols approved by the MDACC Investigational Review Board (IRB). Informed consent had been obtained in accordance with the Declaration of Helsinki. We compared 383 negative and 76 positive FLT3/ITD patients at diagnosis which were analyzed for DLX1 and 187 other proteins. The samples were normalized to a concentration of 1 x 104 cells/L and a whole-cell lysate prepared. Briefly, patient samples were printed in 5 serial dilutions onto slides along with normalization and expression controls. Slides were probed with a strictly validated primary antibody against ARC (Imgenex, San Diego, CA) and a secondary antibody to amplify the signal, and finally a stable dye was precipitated. The stained slides were analyzed using MicroVigene software (Vigene Tech, Carlisle, MA) to produce quantified data. The RPPA data has been properly normalized. ANOVA analysis of protein levels was used to assess the association of protein level to categorical clinical variables. Statistical analysis Nonparametric Mann-Whitney test was performed to assess difference of gene expression measured by quantitative RT-PCR. Results Changes in DLX1/2 expression by FLT3 signaling. To search for possible interactions between FLT3 signaling and HOX gene expression, we first used MV4;11 cells, which were derived from a monocytic leukemia containing a FLT3/ITD gain of function mutation. These cells were treated with PKC412, a FLT3 inhibitor, and real-time quantitative RT-PCR was used to examine HOX expression (see Methods). Although we expected to find downregulation of the HOXA or HOXB genes, only DLX1 and DLX2 8 DOI: 10.3324/haematol.2010.031179 expression were reproducibly affected by FLT3 inhibition (Ct values are shown in Table S1). Other DLX genes were not expressed in these cell lines. At 24 hours, DLX1 and DLX2 mRNA levels were decreased by 4.8 and 3.3-fold (Figure 1A). The mRNA changes were mirrored at the protein level and reduced DLX1 protein expression could be observed as early as at 5 hrs after addition of PKC412 (Figure 1A). To demonstrate that the change in DLX1 was unrelated to non-specific toxicity, we analyzed MV4;11 cells by flow cytometry following treatment with PKC412. No effects on cell-cycle parameters were evident after 2 or 5 hrs (Supplementary Figure S1A), although by 24 hours the cells were arrested in G0/G1. Furthermore, there was no evidence of a sub-G1 peak (i.e., DNA fragmentation), nor did we see any significant change in viability as assessed by trypan blue exclusion. To further test for non-specific effects, we treated MV4;11 cells with 0.1uM imatinib mesylate, an ABL inhibitor; no significant change in DLX1 expression was observed after 24 hours (Supplementary Figure S1B). In contrast, treatment of cells with Staurosporine, a general tyrosine kinase inhibitor, led to widespread changes in most HOX genes examined (data not shown). To confirm that FLT3 signaling affects DLX1 levels, we used the lymphoid leukemic cell line, RS4;11, which contains the same t(4;11) MLL/AF4 fusion gene as MV4;11 cells but has wild-type FLT3 and low DLX1 levels. FLT3 signaling was activated by the addition of FLT ligand (100 ng/ml) for 2, 5 and 24 hours and DLX1/2 expression was examined. Increased DLX1 protein was evident within 5 hours; corresponding DLX1 mRNA levels were elevated 2.6-fold and DLX2 expression was increased by 2.4-fold (Figure 1B). To demonstrate that FLT3 activation affects DLX1 levels in patients, we first examined 469 AML patients for DLX1 protein levels by reverse phase protein array (RPPA). The group of 383 patients negative for FLT3/ITD had significantly lower expression of DLX1 then 76 patients positive for FLT3/ITD (p=0.0004; Figure 2A). At the mRNA level, we examined DLX1 expression in diagnostic samples from 18 additional AML patients with or without FLT3/ITD mutations (patient characteristics are shown in Supplementary Table S2). Patients with FLT3/ITD mutations had significantly higher expression of DLX1 compared to patients with wild-type FLT3 (Figure 2B). Lastly, we isolated bone marrow cells from patients with AML containing a FLT3 wild 9 DOI: 10.3324/haematol.2010.031179 type or FLT3/ITD alteration. After 24 hours of ex vivo treatment with PKC412, DLX1 was decreased only in FLT3/ITD positive patient blasts approximately by 3.1-fold. (Figure 2C). Thus, we conclude that FLT3 signaling affects expression of DLX1 and 2 in both cell lines and patient samples. Regulation of DLX1 downstream of FLT3 signaling FLT3 mediates signaling through three known pathways (RAS, PI3K and STAT5). We used specific inhibitors affecting ERK1/2 (U0126, a MEK1/2 inhibitor), JNK1/2 (SP600125), p38 MAPK (SB203580) and PI3K (LY294002) to look for effects on DLX expression in the RS4;11 and MV4;11 cell lines. For RS4;11, the cells were first incubated with the various inhibitors for 1 hour, then treated with FLT ligand for up to 24 hours with measurement of mRNA levels at 2, 5 and 24 hour time-points. FLT ligand treatment of RS4;11 cells caused an approximate 2.5-fold induction of DLX1, whereas U0126 and SP600125 reduced expression back to basal levels (Figure 1C). In contrast, neither the p38 or PI3K inhibitors had any significant effect. For MV4;11 (with constitutively activated FLT3), DLX1 expression was monitored at 2, 5 and 24 hours after addition of the inhibitors. Similar to the results in RS4;11 cells, blocking ERK1/2 and JNK1/2 activation with U0126 and SP600125 inhibited DLX1 expression and, moreover, the degree of inhibition was similar to that following FLT3 inhibition with PKC412 (i.e., 4-fold change; Figure 1D). LY294002 also inhibited DLX1 expression, although not to the same degree as the ERK1/2 and JNK1/2 inhibitors, and only at 5 the hour time-point. Blocking p38 had no effect on DLX1. These results demonstrate that both ERK1/2 and JNK1/2 participate in the regulation of DLX1 mRNA expression in both RS4;11 and MV4;11 cell lines. For DLX2, only U0126 inhibited expression consistently in both cell lines (data not shown). 10 DOI: 10.3324/haematol.2010.031179 To search for an ERK/JNK responsive transcription factor binding site in DLX1, we used multiple-sequence alignment analysis, i.e., Mulan (http://mulan.dcode.org/Mulan), which identifies local sequence conservation for the detection of evolutionarily conserved transcription factor binding sites. Activation of JNK and ERK pathways results in upregulation of the c-Jun and c-Fos gene products, which together comprise the AP-1 transcription factor. Of note, a conserved AP-1 dimer binding site, TGAGTCA, was found at 205 bp upstream from the DLX1 transcription start site (Supplementary Figure S2). Repressive effect of DLX1 on TGF signaling. It was previously shown that DLX1 is able to bind Smad4 and block TGF signaling (27). To determine whether FLT3 inhibition with PKC412 and the downregulation of DLX1 affected TGF target genes, we treated MV4;11 cells with threshold levels of TGF1 (1-5 ng/ml) and PKC412 (0.1 M) separately, or in combination, along with an analysis of selected TGF target gene expression (p15, CUTl-1, p21, Id-2 and PAI-1) using qRT-PCR. TGF1 alone induced p15 by 2-fold, CUTL-1 by 1.7-fold, and caused a 30-fold increase in PAI-1. PKC412 modestly increased the expression of p15 and CUTl-1 by 2.4 and 2.0-fold, respectively, but had no effect on PAI-1. The combination of PKC412 and TGF1 led to a further modest increase in target gene expression, i.e., PAI-1 (37-fold induction), p15 (3.5-fold induction) and CUTl-1 (2.2-fold induction, Figure 3A). In addition, we isolated bone marrow cells from a patient with AML containing a FLT3/ITD and treated these with PKC412 (Figure 2B). p15 levels were upregulated by 2.5-fold, as were levels of CUTL-1 (1.7-fold) and Id2 (1.7-fold) . Although the effects of PKC412 on TGF gene expression were reproducible, this agent is not specific for FLT3. To confirm that DLX1 levels could be responsible for the effects observed with PKC412, we used RNA interference to inhibit DLX1 and treated MV4;11 cells with threshold levels of TGF1 (5 ng/ml for 24 hours). The siRNA against DLX1 reduced its level by 3-fold (Figure 3B) and caused a significant enhancement in the expression of p15, CUTL-1, PAI-1 and Id2 compared to TGF1 11 DOI: 10.3324/haematol.2010.031179 alone. Moreover, these changes were quite similar to the effects observed with PKC412 (Figure 3A). We then asked whether FLT3 stimulation would have the opposite effect in RS4;11 cells, which are otherwise responsive to TGF1 as evidenced by increased levels of CUTL-1, PAI-1 and Id2. As anticipated, the addition of FLT ligand reduced the expression of CUTL-1 (2-fold), PAI-1 (1.5-fold) and Id2 (1.5-fold) at 24 hours (Figure 4A), whereas p15 was not expressed in this cell line. Importantly, silencing DLX1 abrogated the effect of FLT ligand and brought TGF target genes back to their basal level (Figure 4B). Since TGF can induce a G1/G0 cell-cycle and growth arrest, we used MTS assays to monitor the growth of MV4;11 cells following treatment with three different concentrations of TGF1, either alone (based on the half-maximal inhibitory concentration (IC50) or in combination with varying concentrations of PKC412 (6.25 to 100 nM). At higher concentrations, TGF1 and PKC412 alone were able to cause a cytostatic effect on the leukemic cells. However, at threshold concentrations of TGF1 (0.3 and 0.6 ng/ml), we observed an enhanced cytostatic effect when combined with a low concentration (6.25 nM) of PKC412 (Figure 5). PKC412 affects levels of nuclear phospho-Smad2 TGF pathway activation results from ligand binding to the type II receptor and phosphorylation of a regulatory (R) Smad (e.g., Smad2, Smad3) by the type I receptor. The phosphorylated R-Smad then associates with Smad4 and the complex translocates to the nucleus to regulate gene expression (28). We examined the phosphorylation and nuclear translocation of Smad2/Smad3 in MV4;11 cells treated with TGF1 and PKC412. The addition of TGF1 (1.2 and 0.6 ng/ml) in serum-starved conditions led to increased nuclear Smad2 phosphorylation, as expected. Although PKC412 as a single agent did not increase nuclear phospho-Smad2, it reproducibly enhanced its levels at 2 hours after stimulation with TGF1 (Figure 6A), while total Smad2 remained unchanged (Figure 6B). These results are consistent with the observed changes in TGF target gene expression following inhibition (or stimulation). Whether the changes in nuclear 12 DOI: 10.3324/haematol.2010.031179 phospho-Smad2 result directly from the reported interaction between DLX1 and Smad4 or involve another mechanism is unknown. Discussion We describe here a novel and specific relationship between the homeodomain genes, DLX1 and DLX2, and FLT3 kinase activity. This relationship was observed both in leukemic cell lines and in patient samples. Furthermore, at least in vitro, this relationship appears to have functional consequences on TGF target gene expression and signaling (Figure S3). We initiated this study based on previous results in patient samples suggesting that the expression of certain HOX genes correlated with FLT3 mRNA levels (16). To pursue this, we utilized two t(4;11) translocation containing cell lines, MV4;11 and RS4;11, which express constitutively active and wild-type FLT3 receptors, respectively. Among many homeodomain genes examined by qRT-PCR following FLT3 manipulation, only DLX1 and DLX2 mRNAs were consistently affected. Short-term inhibition of mutated FLT3 in MV4;11 cells by PKC412 caused downregulation of DLX1/2, while exposure of RS4;11 cells to FLT3 ligand resulted in DLX upregulation. Although the survival of MV4;11 cells is dependent on FLT3 signaling (29), downregulation of DLX1/2 preceded any measurable evidence of PKC412-mediated toxicity using trypan blue exclusion and sub-G1 DNA content as indices. While these indices might have been insufficiently sensitive, the corroborative results from FLT3 stimulation in RS4;11 cells strongly support the proposed regulatory interaction. Moreover, DLX1 levels were also downregulated by PKC412 in blast cells isolated from patients with FLT3/ITD positive AML, and our reverse phase arrays demonstrated a highly significant correlation between activating the presence of FLT3 mutations (ITDs) and DLX1 protein expression. Mechanistically, a link between DLX1 regulation and FLT3 signaling appears to involve the ERK and JNK pathways, which are known to affect AP-1 levels, and a conserved AP-1 binding site was identified in the promoter region of DLX1. 13 DOI: 10.3324/haematol.2010.031179 The DLX genes were originally identified in the forebrain of the developing mouse embryo. Although individual DLX1 and DLX2 knockouts do not cause forebrain deformities, the double knockout exhibits abnormalities in facial structures and is neonatally fatal (30, 31). In addition, DLX1 was shown to be a negative regulator of definitive erythropoiesis (27). Aberrant expression of DLX family members has also been associated with breast, ovarian and lung cancer progression / invasiveness (32-34). Previous studies have demonstrated that DLX1 negatively affects TGF signaling by direct interactions with Smad4 (27), a key downstream effector of TGF/BMP signaling. Interactions between Smads and HOX genes were also shown in other studies (35, 36). We observed that the decrease in DLX expression by either PKC412 treatment or following siRNA-mediated knockdown of DLX1 was functionally significant, as evidenced by the upregulation p15, CUTL-1 and Id2, known TGF target genes (37-39). In contrast, FLT3 stimulation in RS4;11 cells led to a repression of CUTL-1, Id2 and PAI-1 mRNAs. This effect was blocked by siRNA-mediated DLX1 knockdown, thus confirming its direct role in the regulation. The p15, CUTL-1, Id2 and PAI-1 genes were not affected equally; however, the changes were reproducible and in the expected direction (upregulation vs. downregulation). There are several possible explanations for the lack of response in PAI-1 expression after PKC412 treatment in MV4;11 cells, as well as in patient blasts. The transcriptional effects of SMADs are known to be dependent on the presence of other co-activators or co-repressors (40). PKC412 is also not specific for FLT3 signaling and potentially could affect other pathways that interfere with PAI-1 activation. In addition, a novel type of ITD mutation not localized in juxtamembrane region of the FLT3 receptor was recently discovered by Breitenbuecher et al (41). This mutation was detected in about 29% of FLT3/ITD positive patients and was associated with persistance of phosphorylated-ERK1/2 despite PKC412 treatment. In addition, TGF signaling is known to inhibit proliferation of hematopoietic cells, and mutations in this pathway contribute to the growth of AML blasts (28, 42). We found that the combination of threshold levels of both TGF and PKC412 caused more growth inhibition than either agent alone, which is consistent with an enhanced TGF response, although other interpretations are not excluded. 14 DOI: 10.3324/haematol.2010.031179 Recent data indicate that Smads may repress gene expression by interacting with co-repressor complexes associated with TGIF, HOXC8 and ATF2 (43-45). Using nuclear-cytoplasmic fractionation and Western blots, we found that PKC412 reproducibly enhanced the level of nuclear phospho-Smad2 induced by TGF1 at 2 hours, while total Smad2 was unchanged. Mechanistically, because DLX1 has been reported to bind and sequester Smad4, reducing the level of DLX1 might result in more translocation of a p-Smad2/p-Smad3/Smad4 complex to the nucleus. In addition, it has been reported that ERK-mediated phosphorylation of Smad1-3 impairs nuclear transport and signaling activity of these proteins (40-42). Thus, inhibition of FLT3, which is known to signal in part by phospho-ERK1/2, would be predicted to enhance nuclear transport of phosphorylated Smad2. However, uncovering this mechanism will require further investigation. In summary, our results demonstrate that FLT3 signaling leads to the specific upregulation in DLX1/2 expression at both the RNA and protein levels in leukemic cell lines and patient samples. Although the full consequences of this upregulation remained undetermined, we suggest that effects on TGF target gene expression and cell growth may be involved. Thus, FLT3 signaling in leukemia may function in part through DLX1/2 to overcome the growth inhibitory effects of TGF. Given the frequency of FLT3 alterations in AML, more investigation into the role of DLX1/2 in the disease process seems warranted. Funding HD was supported by the National Institutes of Health, CA97710. JS was supported by GACR 301/08/P532, MSM0021620813 and IGA NR9526. Acknowledgments The authors would like to thank to R. Webster and J. Trka for critical reading of the manuscript. 15 DOI: 10.3324/haematol.2010.031179 Authorship and Disclosures HD was the principal investigator and co-ordinated the study. JS performed the laboratory work for this study and wrote the paper. SG performed screening by qRT-PCR on cell lines. SK and YQ co-ordinated RPPA study on patient samples. NZ participated in the statistical analysis. IH worked on ex vivo experiments. The authors have no conflicts of interests and no competing financial interests to disclose. References: 1. Apiou F, Flagiello D, Cillo C, Malfoy B, Poupon MF, Dutrillaux B. Fine mapping of human HOX gene clusters. Cytogenet Cell Genet. 1996;73(1-2):114-5. 2. Fujino T, Suzuki A, Ito Y, Ohyashiki K, Hatano Y, Miura I, et al. Singletranslocation and double-chimeric transcripts: detection of NUP98-HOXA9 in myeloid leukemias with HOXA11 or HOXA13 breaks of the chromosomal translocation t(7;11)(p15;p15). Blood. 2002;99(4):1428-33. 3. Lahortiga I, Belloni E, Vazquez I, Agirre X, Larrayoz MJ, Vizmanos JL, et al. NUP98 is fused to HOXA9 in a variant complex t(7;11;13;17) in a patient with AMLM2. Cancer genetics and cytogenetics. 2005;157(2):151-6. 4. Nakamura T. NUP98 fusion in human leukemia: dysregulation of the nuclear pore and homeodomain proteins. International journal of hematology. 2005;82(1):21-7. 5. Nishiyama M, Arai Y, Tsunematsu Y, Kobayashi H, Asami K, Yabe M, et al. 11p15 translocations involving the NUP98 gene in childhood therapy-related acute myeloid leukemia/myelodysplastic syndrome. Genes, chromosomes & cancer. 1999;26(3):215-20. 6. Hanson RD, Hess JL, Yu BD, Ernst P, van Lohuizen M, Berns A, et al. Mammalian Trithorax and polycomb-group homologues are antagonistic regulators of homeotic development. Proc Natl Acad Sci U S A. 1999;96(25):14372-7. 7. Rozovskaia T, Feinstein E, Mor O, Foa R, Blechman J, Nakamura T, et al. Upregulation of Meis1 and HoxA9 in acute lymphocytic leukemias with the t(4 : 11) abnormality. Oncogene. 2001;20(7):874-8. 8. Crooks GM, Fuller J, Petersen D, Izadi P, Malik P, Pattengale PK, et al. Constitutive HOXA5 expression inhibits erythropoiesis and increases myelopoiesis from human hematopoietic progenitors. Blood. 1999;94(2):519-28. 9. Sauvageau G, Thorsteinsdottir U, Hough MR, Hugo P, Lawrence HJ, Largman C, et al. Overexpression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation. Immunity. 1997;6(1):13-22. 10. Antonchuk J, Sauvageau G, Humphries RK. HOXB4 overexpression mediates very rapid stem cell regeneration and competitive hematopoietic repopulation. Exp Hematol. 2001;29(9):1125-34. 11. Kyba M, Perlingeiro RC, Daley GQ. HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell. 2002;109(1):29-37. 16 DOI: 10.3324/haematol.2010.031179 12. Nakamura T, Largaespada DA, Shaughnessy JD, Jr., Jenkins NA, Copeland NG. Cooperative activation of Hoxa and Pbx1-related genes in murine myeloid leukaemias. Nature genetics. 1996;12(2):149-53. 13. Horton SJ, Grier DG, McGonigle GJ, Thompson A, Morrow M, De Silva I, et al. Continuous MLL-ENL expression is necessary to establish a "Hox Code" and maintain immortalization of hematopoietic progenitor cells. Cancer Res. 2005;65(20):9245-52. 14. Zeisig BB, Milne T, Garcia-Cuellar MP, Schreiner S, Martin ME, Fuchs U, et al. Hoxa9 and Meis1 are key targets for MLL-ENL-mediated cellular immortalization. Mol Cell Biol. 2004;24(2):617-28. 15. Drabkin HA, Parsy C, Ferguson K, Guilhot F, Lacotte L, Roy L, et al. Quantitative HOX expression in chromosomally defined subsets of acute myelogenous leukemia. Leukemia. 2002;16(2):186-95. 16. Roche J, Zeng C, Baron A, Gadgil S, Gemmill RM, Tigaud I, et al. Hox expression in AML identifies a distinct subset of patients with intermediate cytogenetics. Leukemia. 2004;18(6):1059-63. 17. Andreeff M, Ruvolo V, Gadgil S, Zeng C, Coombes K, Chen W, et al. HOX expression patterns identify a common signature for favorable AML. Leukemia. 2008;22(11):2041-7. 18. Kottaridis PD, Gale RE, Linch DC. Flt3 mutations and leukaemia. Br J Haematol. 2003;122(4):523-38. 19. Zhang S, Fukuda S, Lee Y, Hangoc G, Cooper S, Spolski R, et al. Essential role of signal transducer and activator of transcription (Stat)5a but not Stat5b for Flt3dependent signaling. J Exp Med. 2000;192(5):719-28. 20. Rosnet O, Buhring HJ, deLapeyriere O, Beslu N, Lavagna C, Marchetto S, et al. Expression and signal transduction of the FLT3 tyrosine kinase receptor. Acta Haematol. 1996;95(3-4):218-23. 21. Stirewalt DL, Radich JP. The role of FLT3 in haematopoietic malignancies. Nat Rev Cancer. 2003;3(9):650-65. 22. Gale RE, Hills R, Kottaridis PD, Srirangan S, Wheatley K, Burnett AK, et al. No evidence that FLT3 status should be considered as an indicator for transplantation in acute myeloid leukemia (AML): an analysis of 1135 patients, excluding acute promyelocytic leukemia, from the UK MRC AML10 and 12 trials. Blood. 2005;106(10):3658-65. 23. Gale RE, Hills R, Pizzey AR, Kottaridis PD, Swirsky D, Gilkes AF, et al. Relationship between FLT3 mutation status, biologic characteristics, and response to targeted therapy in acute promyelocytic leukemia. Blood. 2005;106(12):3768-76. 24. Levis M, Small D. FLT3: ITDoes matter in leukemia. Leukemia. 2003;17(9):1738-52. 25. Zhou QP, Le TN, Qiu X, Spencer V, de Melo J, Du G, et al. Identification of a direct Dlx homeodomain target in the developing mouse forebrain and retina by optimization of chromatin immunoprecipitation. Nucleic Acids Res. 2004;32(3):884-92. 26. Spurrier B, Ramalingam S, Nishizuka S. Reverse-phase protein lysate microarrays for cell signaling analysis. Nat Protoc. 2008;3(11):1796-808. 27. Chiba S, Takeshita K, Imai Y, Kumano K, Kurokawa M, Masuda S, et al. Homeoprotein DLX-1 interacts with Smad4 and blocks a signaling pathway from activin A in hematopoietic cells. Proc Natl Acad Sci U S A. 2003;100(26):15577-82. 17 DOI: 10.3324/haematol.2010.031179 28. Fortunel NO, Hatzfeld A, Hatzfeld JA. Transforming growth factor-beta: pleiotropic role in the regulation of hematopoiesis. Blood. 2000;96(6):2022-36. 29. Armstrong SA, Kung AL, Mabon ME, Silverman LB, Stam RW, Den Boer ML, et al. Inhibition of FLT3 in MLL. Validation of a therapeutic target identified by gene expression based classification. Cancer Cell. 2003;3(2):173-83. 30. Thomas BL, Tucker AS, Qui M, Ferguson CA, Hardcastle Z, Rubenstein JL, et al. Role of Dlx-1 and Dlx-2 genes in patterning of the murine dentition. Development. 1997;124(23):4811-8. 31. de Melo J, Du G, Fonseca M, Gillespie LA, Turk WJ, Rubenstein JL, et al. Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina. Development. 2005;132(2):311-22. 32. Hara F, Samuel S, Liu J, Rosen D, Langley RR, Naora H. A homeobox gene related to Drosophila distal-less promotes ovarian tumorigenicity by inducing expression of vascular endothelial growth factor and fibroblast growth factor-2. Am J Pathol. 2007;170(5):1594-606. 33. Man YG, Fu SW, Schwartz A, Pinzone JJ, Simmens SJ, Berg PE. Expression of BP1, a novel homeobox gene, correlates with breast cancer progression and invasion. Breast Cancer Res Treat. 2005;90(3):241-7. 34. Tomida S, Yanagisawa K, Koshikawa K, Yatabe Y, Mitsudomi T, Osada H, et al. Identification of a metastasis signature and the DLX4 homeobox protein as a regulator of metastasis by combined transcriptome approach. Oncogene. 2007;26(31):4600-8. 35. Williams TM, Williams ME, Heaton JH, Gelehrter TD, Innis JW. Group 13 HOX proteins interact with the MH2 domain of R-Smads and modulate Smad transcriptional activation functions independent of HOX DNA-binding capability. Nucleic Acids Res. 2005;33(14):4475-84. 36. Walsh CM, Carroll SB. Collaboration between Smads and a Hox protein in target gene repression. Development. 2007;134(20):3585-92. 37. Michl P, Downward J. CUTL1: a key mediator of TGFbeta-induced tumor invasion. Cell Cycle. 2006;5(2):132-4. 38. Michl P, Ramjaun AR, Pardo OE, Warne PH, Wagner M, Poulsom R, et al. CUTL1 is a target of TGF(beta) signaling that enhances cancer cell motility and invasiveness. Cancer Cell. 2005;7(6):521-32. 39. Singh K, Mogare D, Giridharagopalan RO, Gogiraju R, Pande G, Chattopadhyay S. p53 target gene SMAR1 is dysregulated in breast cancer: its role in cancer cell migration and invasion. PLoS ONE. 2007;2(7):e660. 40. Gomis RR, Alarcon C, Nadal C, Van Poznak C, Massague J. C/EBPbeta at the core of the TGFbeta cytostatic response and its evasion in metastatic breast cancer cells. Cancer Cell. 2006;10(3):203-14. 41. Breitenbuecher F, Schnittger S, Grundler R, Markova B, Carius B, Brecht A, et al. Identification of a novel type of ITD mutations located in nonjuxtamembrane domains of the FLT3 tyrosine kinase receptor. Blood. 2009;113(17):4074-7. 42. Tessier N, Hoang T. Transforming growth factor beta inhibits the proliferation of the blast cells of acute myeloblastic leukemia. Blood. 1988;72(1):159-64. 43. Massague J, Wotton D. Transcriptional control by the TGF-beta/Smad signaling system. EMBO J. 2000;19(8):1745-54. 18 DOI: 10.3324/haematol.2010.031179 44. Shi X, Yang X, Chen D, Chang Z, Cao X. Smad1 interacts with homeobox DNAbinding proteins in bone morphogenetic protein signaling. J Biol Chem. 1999;274(19):13711-7. 45. Shi Y, Massague J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 2003;113(6):685-700. Figure 1. Effect of PKC412 on DLX1 and DLX2 gene expression (A) Y axis shows the fold-change of gene expression of DLX1 and DLX2 in samples treated 0, 2, 5 and 24 hours with kinase inhibitors. Western blot shows effectiveness of PKC412 drug to pFLT3 inhibition and DLX1 protein expression in MV4;11 cell line. (B) Fold-change of DLX1 and DLX2 expression in RS4;11 cells treated 2, 5 and 24 hours with FLT ligand (100ng/ml) and DLX1 and DLX2 mRNA levels were detected. Western blot shows DLX1 protein expression in RS4;11 cell line. (C) Normalized DLX1 expression in RS4;11 (5 hours) and (D) MV4;11 (5 hours) cell lines after the treatment with ERK1/2 (U0126, 10M), JNK1/2 (SP600125, 10M), PI3K (LY294002, 10M) and p38 (SB203580, 10M) inhibitors in FLT3 activated pathway. Asterisks correspond to statistically significant change, ***p<0.0001. Figure 2. DLX1 expression in samples from AML patients and effect of PKC42 ex vivo (A) Box plots showing results of RPPA analysis in AML patients characterized according FLT3 status (NEG FLT3wt; POS FLT3/ITD) by using ANOVA test (B) Box plot describing results of Mann-Whitney statistical test in diagnostic samples of AML patients with (FLT3/ITDpos) or without FLT3/ITD (FLT3/ITDneg) of DLX1 expression (C) Relative expression of DLX1 presented as fold-change was detected in leukemic blasts isolated from bone marrow cells of AML patients with FLT3 wild-type or FLT3/ITD mutation. Moreover, the expression of DLX2, CUTL-1, p15 and Id2 was studied in leukemic blasts isolated from bone marrow of AML patient with FLT3/ITD and treated with PKC412 for 24 hours. Asterisks correspond to statistically significant changes, *p0.02, **p0.001. 19 DOI: 10.3324/haematol.2010.031179 Figure 3. Expression of p15, CUTL-1 and PAI-1 genes (A) Graphs describe foldchange of p15, CUTL-1 and PAI-1 genes in MV4;11 cells after PKC412 (0.1 M) and TGF1 (1, 2, 3, 5 ng/ml) treatment alone or in combination normalized to untreated control cells and effect of siDLX1 in the presence of TGF1 (5ng/ml). All measurements were performed 24 hours after treatment. All measurements were done in triplicates. (B) Downregulation of DLX1 in MV4;11 cells using siRNA after 24 hours. Asterisks correspond to statistically significant change, **p0.0008. Figure 4. Knockdown of DLX1 (siDLX1) alters response to TGF1 and FLT3 ligand. (A) Relative expression of CUTL-1 and PAI-1 in RS4;11 cells treated with TGF 1 (5 ng/ml) or FLT ligand (100 ng/ml) for 24 hours compared to untreated control cells; (B) Downregulation of DLX1 in RS4;11 cells using siRNA after 24 hours blocks FLT3 ligand-mediated suppression of CUTL-1 and PAI-1. Cells were transfected with either non-targeted siRNA (control) or siDLX1 and exposed to FLT3 (100 ng/ml for 24 hours). Asterisks correspond to statistically significant changes, *p<0.05; **p0.0004. Figure 5. Cytostatic effect of PKC412, TGF1 and the combination Results of MTS assay using threshold concentrations of TGF1 (T) and PKC412 (P) and the combination (T+P) were monitored 72 hours after incubation. Experiments were done in triplicate and the standard deviation was calculated. Asterisks correspond to statistically significant changes, *p0.03; **p0.005; ***p<0.0001. Figure 6. Effect of PKC412 on phosphorylation of Smad2 (A) Phospho-Smad2 detected by Western blot in MV4;11 cells treated with PKC412 (0.1 M) and TGF1 (0.6 and 1.2ng/ml) alone, or in combination, in nuclear and cytoplasmic fractions at 2 hours. CREB-1 (nuclear protein) and GAPDH (cytoplasmic protein) were used as controls. Values from densitometry are shown. (B) Total Smad2 was detected in whole lysates. All experiments were done in independent triplicates. Representative examples are shown. 20 Figure 1 DOI: 10.3324/haematol.2010.031179 Control PKC412 A p-FLT3 B-actin MV4;11 norm. DLX1 mRNA norm. DLX2 mRNA 1.4 *** 1.2 *** 1 0.8 0.6 0.4 0.2 0 0h 2h 5h 1.4 1.2 1 *** *** 0.8 0.6 0.4 0.2 0 0h 2h 5h DLX1 actin PKC412 _0 2 + 5 24 ++ B control PKC412 *** 24h *** 24h 35kDa 42kDa norm. DLX2 mRNA norm. DLX1 mRNA 3 2.5 2 1.5 1 0.5 0 0h 3 2.5 2 1.5 1 0.5 0 0h RS4;11 *** 2h 5h *** *** 2h 5h DLX1 actin 0 FL ligand _ 2 + 5 24 ++ C RS4;11 norm. DLX1 mRNA control FL ligand *** 3 2.5 2 1.5 *** *** *** 1 0.5 0 24h FL ligand - + + + + + D *** 3 MV4;11 norm. DLX1 mRNA 2.5 2 24h 1.5 *** *** *** 1 35kDa 42kDa 0.5 0 control FL U0126 SP600125 SB203580 LY294002 control PKC412 U0126 SP600125 SB203580 LY294002 Figure 2 DOI: 10.3324/haematol.2010.031179 Normalized DLX1 Expression A5 4 3 2 1 0 -1 -2 -3 NEG C 3 2.5 2 1.5 ** 1 POS ITD Median 25%-75% Non-Outlier Range Outliers Extremes F = 14.11 p = 0.0002; KW-H = 13.14 p = 0.0003 norm.DLX1 expression B .16 .14 .12 .1 .08 .06 .04 .02 0 -.02 FLT3/ITDneg p=0.03 FLT3/ITDpos * ** 3 DLX1 2.5 2 1.5 * 1 DLX2 CUTL-1 p15 * * * Id2 control PKC412 * norm.expression 0.5 0.5 0 FLT3/ITD FLT3/ITD FLT3/ITD FLT3 wt 0 norm.DLX1 expression DOI: 10.3324/haematol.2010.031179 Figure 3 A PKC412 (0,1uM) - + - - - - + + + + siDLX1 TGFB1 (ng/ml) 0 0 1 2 3 5 1 2 3 5 5 6B norm. DLX1 mRNA norm. p15 mRNA 5 4 3 ** 2 ** ** ** ** MV4;11 1.5 ** 1 0.5 1 0 2,5 ** 2 ** ** ** ** 0 sinonT siDLX1 norm. CUTL-1 mRNA 1,5 1 0,5 norm. PAI-1 mRNA 0 ** 45 ** 40 ** 35 ** 30 25 20 15 10 5 0 Figure 4 DOI: 10.3324/haematol.2010.031179 norm. PAI-1 mRNA norm. CUTL-1 mRNA A 1.5 1 0.5 0 2 1.5 1 0.5 B control TGFB1 FLT ligand norm. DLX1 mRNA 1.5 RS4;11 ** 1 0.5 01 control 2 siDLX1 norm. CUTL-1 mRNA RS4;11 1.4 * 1.2 * 1 0.8 0.6 0.4 0.2 0 control control siDLX1 ** ** norm. PAI-1 mRNA 1.4 1.2 1 0.8 0.6 0.4 0.2 0 FLT ligand * * control - control + siDLX1 + Figure 5 absorbance 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 DOI: 10.3324/haematol.2010.031179 *** *** *** ** ** ** * * * Figure 6 DOI: 10.3324/haematol.2010.031179 A 2hours PKC412 - + + +- - TGF1 - - 1.2 0.6 1.2 0.6 p-Smad2 CREB-1 GAPDH 1.2 0.5 0.8 0.6 60kDa 37kDa 37kDa NUCLEAR FRACTION p-Smad2 CREB-1 60kDa 37kDa CYTOPLASMIC FRACTION GAPDH 37kDa B 2hours PKC412 + + + - - TGF1 - 1.2 0.6 1.2 0.6 Smad2 B-actin 60kDa 42kDa WHOLE LYSATE Figure S1 %of cells norm.DLX1 mRNA A 100 80 60 40 subG1 G2/M S G1/G0 B 1.6 1.2 0.8 20 0.4 0 0h 2h 5h 24h 0 0h control imatinib 2h 24h Specificity and non-toxicity of PKC412 in MV4;11 cells (A) Results from flow cytometry analysis are shown as a percentage of cells in subG1, G1-G0, S and G2-M phase of cell cycle after 0, 2, 5 and 24 hour treatment of MV4;11 cells with PKC412. (B) Graph shows fold-change of DLX1 gene expression in MV4;11 cells after imatinib treatment Figure S2 DOI: 10.3324/haematol.2010.031179 AP1-binding site in DLX1 promoter promoter AGCGGAGCCCGAGCGCCTCGGACCAATCCCCAGTGATTATGCAAGACAGCGGACCAAT TCGCCTCGGGCTCGCGGAGCCTGGTTAGGGGTCACTAATACGTTCTGTCGCCTGGTTA promoter AP-1b.site Exon 1 CAGCTCCGCCAGCTCATGAATATTTATGACCTTCGCTGAGTCAAAGCTTTGAACCGAGT GTCGAGGCGGRCGAGTACTTATAAATACTGGAAGCGACTCAGTTTCGAAACTTGGCTCA CDC start TTGGGGAGCTCAGCAGCATCATGCTTAGACTTTTCAAAGAGACAAACTCCATTTTCTTAT AACCCCTCGAGTCGTCGTAGTACGAATCTGAAAAGTTTCTCTGTTTGAGGTAAAAGAATA Figure S3 FLT3 lig FLT3/ITD RAS PI3K STAT5 MEK1/2 pERK1/2 pJNK Fos/Jun DLX1 p-Smad2/pSmad3 Smad4 Smad4 p15, Cutl-1, Pai-1, Id2 DOI: 10.3324/haematol.2010.031179 Table S1 HoxA1 HoxA2 HoxA3 Hox A4 HOXA5 HOXA6 HOXA7 HOXA9 Hox A10 Hox A11 Hox A13 Hox B2 Hox B3 Hox B4 Hox B5 Hox B6 Hox B7 Hox B8 Hox B9 Hox B13 Hox C4 0h 11.69 13.78 13.94 10.98 11.88 12.47 ND 6.05 5.81 ND ND ND 8.58 7.52 12.79 6.14 11.48 ND ND ND ND PKC412 (0.1M) 24h 11.715 Hox C5 11.7 Hox C6 12.06 Hox C8 10.47 Hox C9 10.91 Hox C10 13.06 Hox D3 ND Hox D4 5.19 Hox D8 5.49 Hox D9 ND Hox D10 ND Hox D13 ND PBX2 6.95 PBX3 6.5225 Meis1 10.38 Meis2 6.145 DLX1 10.36 DLX2 ND EN1 ND DLX6 ND GBX2 ND 0h ND 9.84 ND 10.95 11.27 ND ND ND ND ND ND 5.83 6.2 5.01 8.9 5.28 10.26 ND ND ND 24h ND 8.7 ND 9.66 10.53 ND ND ND ND ND ND 5.15 5.81 4.13 8.35 7.5 11.87 ND ND ND DOI: 10.3324/haematol.2010.031179 Table S2 patient M1 M53 M60 M73 M81 M82 M86 M312 M412 M16 M29 M36 M38 M87 M212 M281 M336 M337 diagnosis Flt3 ITD M4 + M2 + M4 + M2 + M3 + M1 + M3 + M4 + M4 + M2 M2 M4 M2 M0 M4 M0 M5 M0 - Flt3 D835 - PML/RARa + + - AML1/ETO - CBFB/MYH11 - other - blast count 87% 61% 67% 47% 88% 85% 73% 90% 93% 65% 68% 90% 37% 73% 20% 42% 80% 79% DOI: 10.3324/haematol.2010.031179 Table S3 p15 fw 5`- GGCAGTCGATGCGTTCACTC p15 rev 5`- TGCCATGCGCTCAAACTAAAG CUTL-1 fw 5`- CAGCGCCTGCACGATATTG CUTL-1 rev 5`- AGAGCTATGGTTTCGGCTTGG PAI-1 fw 5`- CCACAGACGCGATCTTCGTC PAI-1 rev 5`- GTCCACTTGCTTGACCGTGC p21 fw 5'- CAGCAGAGGAAGACCATGTGG p21 rev 5'- GCCGTTTTCGACCCTGAGAG Id2 fw 5'- CTGACCACCCTCAACACG Id2 rev 5'- CTTGTCCTCCTTGTGAAATGG