Document O3MVNdQzOpMaab66KgemMLxgw

Chromosome Translocations in Workers Exposed to Benzene Cliona M. McHale, Qing Lan, Chiara Corso, Guilan Li, Luoping Zhang, Roel Vermeulen, John D. Curry, Min Shen, Rustam Turakulov, Russell Higuchi, Soren Germer, Songnian Yin, Nathaniel Rothman, Martyn T. Smith Downloaded from http://jncimono.oxfordjournals.org by on March 31, 2010 As benzene has been linked with elevated risk of both acute myeloid leukemia and lymphoma, we explored the effect of benzene exposure on levels of t(8;21), t(15;17), and t(14;18) translocations. Circulating lymphocytes of normal individuals also often contain t(14;18). Quantitative polymerase chain reaction analysis showed that 37 workers with benzene exposure had a decreased level of t(14;18) in their blood with only 16.2% having 10 or more copies of the t(14;18) BCL-2/IgH fusion gene/g DNA, as opposed to 55% of 20 controls (P = .0063 by Fisher's exact test). This decline may be related to the immunotoxicity to specific subtypes of circulating B-lymphocytes, but the data do not support the use of t(14;18) as a biomarker of increased lymphoma risk in benzene-exposed populations. None of 88 individuals (31 controls and 57 exposed) exhibited detectable t(8;21) transcripts, and while t(15;17) transcripts were detected in two individuals, the result is inconclusive as one was exposed and the other was unexposed. J Natl Cancer Inst Monogr 2008;39:7477 Epidemiological studies indicate that benzene exposure is associated with an increased risk of human leukemia and lymphoma (1,2). Chromosomal translocations are thought to be initiating events in leukemia and lymphoma, and specific translocations are used as markers of diagnosis, disease progression, and relapse. As benzene is thought to act by producing chromosomal aberrations and altered cell differentiation (3), we investigated the possibility of using circulating levels of two acute myeloid leukemia (AML) associated translocations, t(8;21) (4) and t(15;17) (5), and a follicular lymphomaassociated translocation, t(14;18) (6), as biomarkers of early effect for benzene. Evidence for the occurrence of these translocations in normal individuals is limited, with t(8;21) detected in 1 in 496 cord blood samples (7) and t(15;17) detected in healthy volunteers (8). As recently reviewed (9), the prevalence of t(14;18) in peripheral blood lymphocytes of healthy donors is relatively high at ~50% (range 8%80% depending on the polymerase chain reaction (PCR) methodology employed and target cell population) (913) and rises with smoking (14), but the correlation between frequency and age remains unclear (13,15). The biological consequences of these aberrations in healthy individuals are yet to be understood. One possibility is that the frequency of translocationpositive cells represents a biomarker of early effect for hematopoietic carcinogens which could correlate with the cumulative risk of developing t(14;18)-related follicular lymphoma and t(8;21)- and t(15;17)-related AML, and perhaps other cancers. The two principal technologies for detection of specific chromosome translocations are fluorescence in situ hybridization (FISH) and real-time PCR. FISH distinguishes individual chromosomes by hybridization with sequence-specific, chromosomepainting probes labeled with spectrally nonoverlapping fluorophores. In real-time quantitative PCR (qPCR), a fluorescently labeled probe is hybridized to the amplification target, and fluorescent signal proportional to the input DNA/cDNA is generated during amplification, thereby allowing quantification. qPCR assays the whole peripheral blood mononuclear cell (PBMC) population in G0, whereas FISH examines a culture-modified population [consisting of mainly mature T lymphocytes stimulated by the mitogen phytohemagglutinin that have gone through two cell divisions (16)]. The two methods also generate different estimates of t(14;18) translocation levels with FISH detecting all possible t(14;18) breakpoints and the real-time assay described here only detecting breakpoints occurring in the major breakpoint region (MBR) of the BCL-2 gene. Although it was previously thought that the majority of BCL-2 breakpoints occur in the MBR (17), it has been shown more recently that many breakpoints occur outside of the MBR and the minor cluster region (18). The ability of FISH to detect more translocation breakpoints is offset by its lower relative sensitivity (300500 metaphases examined per individual) compared with real-time PCR (millions of cells examined per individual). The t(14;18) translocation can be detected at the genomic level but the breakpoints in one or both fusion partners involved in the t(8;21) and t(15;17) translocations occur in very long introns, making detection of the resultant fusion transcripts more practical than detection of the genomic breakpoint, particularly at low frequencies. We previously reported increased levels of t(8;21) by FISH, in workers highly exposed to benzene, and confirmed the presence of the translocation in one individual by reverse transcription PCR (19). We also recently reported the detection of t(14;18) by FISH in 4/22 individuals highly exposed to benzene but not in controls (N = 44) or in lower-exposed workers (N = 21) (20). However, lack of DNA of suitable quality precluded confirmation of t(14;18) by qPCR. In this paper, we describe analysis of chromosomal translocations Affiliations of authors: School of Public Health, University of California, Berkeley, CA (CMH, CC, LZ, JDC, RT, MTS); Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, DHHS, Bethesda, MD (QL, MS, NR); National Institute of Occupational Health and Poison Control, Chinese Center for Disease Control and Prevention, Beijing, China (GL, SY); Institute for Risk Assessment Sciences, Utrecht University, The Netherlands (RV); Roche Molecular Systems, Inc, Alameda, 1145 Atlantic Ave, Alameda, CA (RH). Correspondence to: Martyn T. Smith, PhD, School of Public Health, 140 Warren Hall, University of California, Berkeley, CA 94720-7360 (e-mail: martynts@berkeley.edu). See "Funding" following "References." DOI: 10.1093/jncimonographs/lgn010 The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org. 74 Journal of the National Cancer Institute Monographs, No. 39, 2008 Downloaded from http://jncimono.oxfordjournals.org by on March 31, 2010 t(8;21), t(15;17), and t(14;18) by qPCR in individuals from a more recent molecular epidemiology study of benzene exposure. Methods Characteristics of Study Subjects Peripheral blood was obtained, with written, informed consent, from unexposed controls and individuals occupationally exposed to benzene in factories near Tianjin, China, in 2000 (21,22). The study was approved by Institutional Review Boards at National Cancer Institute and the National Institute of Occupational Health and Poison Control, China, CDC, Beijing. PBMCs were isolated by Ficoll separation within 6 hours of blood collection. RNA was extracted from 94 PBMC samples representing 88 individuals (31 controls, 20 low-exposed [mean 1.8 ppm, median 1.7 ppm benzene], 37 high-exposed [mean 21.9 ppm, median 12.8 ppm], 6 internal quality control samples), using the Qiagen RNeasy kit (Qiagen Inc, Valencia, CA), to screen for t(8;21) and t(15;17). DNA from 20 unexposed controls and 37 individuals exposed to benzene (mean 22.6 ppm, median 13.8 ppm), representing a subset of individuals analyzed for t(15;17) and t(8;21), was extracted using the QIAamp DNA extraction kit (Qiagen Inc) in order to screen for t(14;18). Detection of Translocations by Real-Time and Nested PCR Primers, probes, and protocols for t(14;18) (23), t(8;21) (24, 25), and t(15;17) qPCR are detailed in supplemental Tables S1 and S2 available online. DNA quality was confirmed by qPCR of the -actin gene using 100 ng of DNA (26), and genomic DNA (1 g) was analyzed for t(14;18). The assay routinely detected three copies of template in 1 g of background DNA in two out of three replicates and standard curves consistently yielded R2 values greater than 0.99. For the t(8;21) and t(15;17) assays, cDNA was generated from 1 g RNA using the Superscript first-strand cDNA synthesis kit (Invitrogen, Carlsbad, CA), and integrity of the cDNA was assessed by amplification of 2-microglobulin from 1 L cDNA (27). For each assay, three replicates for each standard, sample, and control were analyzed by qPCR using the ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). Both assays reproducibly detected 10 copies of t(15;17) or t(8;21) translocation transcripts in 1 g background RNA (250 000 lymphocyte cells). The standard curve slopes were 3.75 and 3.27 for the t(15;17) and t(8;21) assays, respectively, and the R2 values were typically >0.99. Nested PCR and DNA sequencing for t(14;18) was carried out as described previously (15). Nested PCR assays for t(8;21) and t(15;17) are detailed in supplementary Tables S3 and S4 available online. Statistical Methods Demographic (sex), lifestyle factors (smoking and alcohol drinking), and infection were compared between exposed workers and controls by Pearson chi-square test or Fisher's exact test if the number of subjects in one cell is smaller than five. Age, translocation copies, and categorization of t(14;18) status by copy number were analyzed by Wilcoxon rank-sum test. Spearman correlation between the categorization of t(14;18) status by copy number and benzene exposure status was calculated. Multivariable models (linear regression of the continuous translocation copy variable and logistic regression of translocation number dichotomized into 0 for no events and 1 for any number of events, and 0 vs 1 for 10 or more events) were used to control for age, sex, smoking, alcohol drinking, and other potential confounding factors. All data analysis was carried out using SAS 9.1.3 (SAS Institute Inc, Cary, NC). Results and Discussion The t(8;21) and t(15;17) translocations were assayed by real-time and nested PCR assays. Screening 88 individuals by qPCR identified two positives for t(15;17), at a level of three to four transcripts per 250 000 cells. The positive samples, from an exposed individual and an unexposed control, were confirmed by nested PCR (Figure 1). This is only the second report of the presence of t(15;17) in healthy volunteers (8). No individuals were positive for t(8;21). As these translocations are rare in normal individuals (7), screening large populations will be necessary to see the true frequencies. The frequency of the t(14;18) translocation among 20 healthy nonexposed individuals and 37 workers exposed to benzene, assayed here by a genomic-based qPCR approach, is shown in Table 1. Surprisingly, the mean number of copies of the t(14;18) BCL-2/IgH fusion gene was significantly lower in the exposed workers (22.3 copies/g DNA) than in the controls (147.6 copies/ g DNA) (P = .0004). Categorization of the data by copy number confirmed that the translocation frequency was statistically significantly greater among the positive individuals from the control group (Table 1). qPCR analysis showed that 37 workers with benzene exposure had a decreased level of t(14;18) in their blood with only 16.2% having 10 or more copies of the t(14;18) BCL-2/IgH fusion gene/g DNA, as opposed to 55% of 20 controls (P = .0063 by Fisher's exact test). The finding of a lower level of t(14;18) translocations in benzene-exposed workers is surprising, but we hypothesize that it may be explained by benzene depressing a subtype of circulating B-cells (22,28). In the current study, B-lymphocyte levels were depressed 36% in exposed (>10 ppm) individuals compared with controls. Figure 1. Nested polymerase chain reaction result for t(15;17). Second-round amplification products are shown. Standards are in vitro transcripts generated from cloned breakpoints, ve = Negative control (human colon RNA), positive samples are circled and denoted by "*." Journal of the National Cancer Institute Monographs, No. 39, 2008 75 Downloaded from http://jncimono.oxfordjournals.org by on March 31, 2010 Table 1. Translocation t(14;18) detected by real-time PCR in benzene-exposed workers and controls Characteristics Control (n = 20) Exposed (n = 37) P value Benzene exposure (ppm) Age Mean SD Median Sex Male Female Currently smoking Yes No Currently drinking Yes No Recent infection Yes No Translocation copies t(14;18) 0 1 2 3 4 t(14;18) No (01) Yes (24) 0 35.2 7.6 36 10 (50%) 10 (50%) 9 (45%) 11 (55%) 7 (35%) 13 (65%) 1 (5%) 19 (95%) 147.6 365.2* (17.65) 4 (20%) 5 (25%) 6 (30%) 4 (20%) 1 (5%) 9 (45%) 11 (55%) 22.6 21.44* (13.78) 36.7 7.7 37 9 (25%) 28 (76%) 8 (22%) 29 (78%) 9 (24%) 28 (76%) 2 (5%) 35 (95%) 22.3 106.1 (0) 25 (68%) 6 (16%) 5 (14%) 1 (3%) 0 31 (84%) 6 (16%) .52 .05 .06 0.39 1|| .0004 0.0002|| 0.0063|| * Mean SD. Median, 0 = negative. Wilcoxon test, 1 = ambiguous. Chi-square test, 2 = positive (10100 copies). || Fisher's exact test, 3 = positive (100999 copies). Categorization of t(14;18) status by copy number, 4 = positive (1000 copies). The t(14;18) translocation is enriched in or restricted to a subtype of B-cells (11, 12, 29), and this subtype may be more susceptible to the toxic effects of benzene. At least some of the t(14;18)-bearing clones are likely to be memory cells rather than naive B-cells, because most BCL-2/IgH clones are long-lived and persist over several years in the periphery (30). Chronic hepatitis C virus infection can promote either the occurrence or maintenance of t(14;18)+ clones (31). The frequency of t(14;18) translocation-positive cells, but not the prevalence, was increased with increasing plasma tetrachlorodibenzo-p-dioxin (TCDD), possibly through alteration of immune parameters and immune response by TCDD (32). As well as depression of the immune system through reduction of B and T lymphocyte numbers, benzene exposure also perturbs their mitogenic responses (33). Table 1 shows the gender and age characteristics of the population as well as smoking and drinking status. Differences in age, drinking, and recent infection were not significant between the two groups, but there were slightly more smokers among the controls (45%) than the exposed workers (22%), P = .06, and smoking has been associated with elevated t(14;18). However, adjusting for age, smoking, alcohol, and other confounding factors by linear and logistic regression resulted in the same negative association of t(14;18) with benzene exposure. Further, results were similar when we excluded subjects with an ambiguous t(14;18) copy number value (Table 1). Overall, our data do not support the utility of circulating lymphocyte t(14;18) levels as a biomarker of early effect for benzene. Nested PCR was used to confirm the presence of t(14;18) in 10 samples positive by real-time PCR (>10 copies) and to obtain DNA fragments for subsequent sequencing (15). Sequence analysis was performed on five PCR products (with fragment length >300 bp) and each showed a different overall sequence (Table 2), similar to that in follicular lymphoma. In three individuals (4, 5, and 7), BCL-2 was fused to JH, whereas in the other two (39 and 40) BCL-2 was fused to DH JH. In the translocation from individual 39, N-regions were observed between the BCL-2 breakpoint and the DH region of the IgH gene, as well as between the DH and JH regions of the IgH gene. The frequency of the t(14;18)positive lymphocytes with more than 10 copies detected in healthy Chinese individuals (55%) was similar to previous frequencies reported for Caucasian populations (15,34) and higher than that reported for Japanese individuals (16%) (34). The Chinese have a similarly lower level of lymphoma as the Japanese in comparison to Western Caucasian populations. Thus, the apparent correlation between lower t(14;18) levels in Japanese subjects and lower lymphoma rates in that country reported previously requires further investigation in larger sample sizes from Asian populations. Table 2. BCL-2/IgH breakpoint sequences from five individuals Sample 4 5 7 39 40 Position in Accession AY220759 193535 193598 193599 193598 BCL-MBR breakpoint CCCTCCTGCCC AGTGGTGCTTA AGTGGTGCTTAC AGTGGTGCTTA 193544 CCCTCCTTCCGC N-region CCTCTCCGGCTCAAGGCCNGAGA ACTGGTTCGACCC TCCCACCGTGT TCCCTTCAGCCGGACAAGAACCCCT CTTGACCAA GTATTACTATGATAGTAGTGGTTAT CGTGGAAGTGTGG TCCCTACTNGGA ATATTGTAGTAGTACCAGCTGCTAT ACC Position in Accession X97051 89762 89788 89768 89788 89764 JH Breakpoint TACTACTAC CTGGGGCCAAGGG TACTACTAC CTGGGGCCAAGG CTACTACTACTAC Diversity (DH) regions are underlined. MBR = major breakpoint region. 76 Journal of the National Cancer Institute Monographs, No. 39, 2008 Downloaded from http://jncimono.oxfordjournals.org by on March 31, 2010 We recently reported increased t(14;18) translocation in highly exposed workers as measured by FISH (20), which is contradictory to our current findings by real-time PCR. The discrepancy may be explained by the different target cell populations and differential sensitivities of the two assays. In conclusion, there are limitations to the use of translocations as biomarkers of early effect for hematologic malignancies. Current detection methodologies may lack the necessary sensitivity for their detection at biologically meaningful levels. Also, although translocations are thought to be initiating events in leukemia, their presence alone does not cause leukemia (35). Additional cooperating mutations are required for disease. As illustrated by the t(14;18) findings presented here, the presence of the translocation in unselected cell populations may not be informative due to other effects of long-term exposure on the immune system. References 1. Hayes RB, Yin S, Rothman N, et al. Benzene and lymphohematopoietic malignancies in China. J Toxicol Environ Health A. 2000;61(56): 419432. 2. Hayes RB, Yin SN, Dosemeci M, et al. Benzene and the dose-related incidence of hematologic neoplasms in China. Chinese Academy of Preventive Medicine--National Cancer Institute Benzene Study Group. J Natl Cancer Inst. 1997;89(14):10651071. 3. Zhang L, Eastmond DA, Smith MT. The nature of chromosomal aberrations detected in humans exposed to benzene. Crit Rev Toxicol. 2002; 32(1):142. 4. Peterson LF, Zhang DE. The 8;21 translocation in leukemogenesis. Oncogene. 2004;23(24):42554262. 5. Sirulnik A, Melnick A, Zelent A, Licht JD. Molecular pathogenesis of acute promyelocytic leukaemia and APL variants. Best Pract Res Clin Haematol. 2003;16(3):387408. 6. Devesa SS, Fears T. Non-Hodgkin's lymphoma time trends: United States and international data. Cancer Res. 1992;52(19):5432s5440s. 7. Mori H, Colman SM, Xiao Z, et al. Chromosome translocations and covert leukemic clones are generated during normal fetal development. Proc Natl Acad Sci USA. 2002;99(12):82428247. 8. Quina AS, Gameiro P, Sa da Costa M, Telhada M, Parreira L. PMLRARA fusion transcripts in irradiated and normal hematopoietic cells. Genes Chromosomes Cancer. 2000;29(3):266275. 9. Janz S, Potter M, Rabkin CS. Lymphoma- and leukemia-associated chromosomal translocations in healthy individuals. Genes Chromosomes Cancer. 2003;36(3):211223. 10. Basecke J, Griesinger F, Trumper L, Brittinger G. Leukemia- and lymphoma-associated genetic aberrations in healthy individuals. Ann Hematol. 2002;81(2):6475. 11. Fuscoe JC, Setzer RW, Collard DD, Moore MM. Quantification of t(14;18) in the lymphocytes of healthy adult humans as a possible biomarker for environmental exposures to carcinogens. Carcinogenesis. 1996; 17(5):10131020. 12. Limpens J, Stad R, Vos C, et al. Lymphoma-associated translocation t(14;18) in blood B cells of normal individuals. Blood. 1995;85(9): 25282536. 13. Schmitt C, Balogh B, Grundt A, et al. The bcl-2/IgH rearrangement in a population of 204 healthy individuals: occurrence, age and gender distribution, breakpoints, and detection method validity. Leuk Res. 2006;30(6): 745750. 14. Bell DA, Liu Y, Cortopassim GA. Occurrence of bcl-2 oncogene translocation with increased frequency in the peripheral blood of heavy smokers. J Natl Cancer Inst. 1995;87(3):223224. 15. Liu Y, Hernandez AM, Shibata D, Cortopassi GA. BCL2 translocation frequency rises with age in humans. Proc Natl Acad Sci USA. 1994;91(19): 89108914. 16. O'Donovan MR, Johns S, Wilcox P. The effect of PHA stimulation on lymphocyte sub-populations in whole-blood cultures. Mutagenesis. 1995; 10(4):371374. 17. Akasaka T, Akasaka H, Yonetani N, et al. Refinement of the BCL2/immunoglobulin heavy chain fusion gene in t(14;18)(q32;q21) by polymerase chain reaction amplification for long targets. Genes Chromosomes Cancer. 1998;21(1):1729. 18. Albinger-Hegyi A, Hochreutener B, Abdou MT, et al. High frequency of t(14;18)-translocation breakpoints outside of major breakpoint and minor cluster regions in follicular lymphomas: improved polymerase chain reaction protocols for their detection. Am J Pathol. 2002;160(3):823832. 19. Smith MT, Zhang L, Wang Y, et al. Increased translocations and aneusomy in chromosomes 8 and 21 among workers exposed to benzene. Cancer Res. 1998;58(10):21762181. 20. Zhang L, Rothman N, Li G, et al. Aberrations in chromosomes associated with lymphoma and therapy-related leukemia in benzene-exposed workers. Environ Mol Mutagen. 2007;48(6):467474. 21. Vermeulen R, Li G, Lan Q, et al. Detailed exposure assessment for a molecular epidemiology study of benzene in two shoe factories in China. Ann Occup Hyg. 2004;48(2):105116. 22. Lan Q, Zhang L, Li G, et al. Hematotoxicity in workers exposed to low levels of benzene. Science. 2004;306(5702):17741776. 23. Luthra R, McBride JA, Cabanillas F, Sarris A. Novel 5' exonuclease-based real-time PCR assay for the detection of t(14;18)(q32;q21) in patients with follicular lymphoma. Am J Pathol. 1998;153(1):6368. 24. Curry J, McHale C, Smith MT. Low efficiency of the Moloney murine leukemia virus reverse transcriptase during reverse transcription of rare t(8;21) fusion gene transcripts. Biotechniques. 2002;32(4):768, 70, 72, 545. 25. Marcucci G, Livak KJ, Bi W, Strout MP, Bloomfield CD, Caligiuri MA. Detection of minimal residual disease in patients with AML1/ETO-associated acute myeloid leukemia using a novel quantitative reverse transcription polymerase chain reaction assay. Leukemia. 1998;12(9):14821489. 26. Sarris AH, Jiang Y, Tsimberidou AM, et al. Quantitative real-time polymerase chain reaction for monitoring minimal residual disease in patients with advanced indolent lymphomas treated with rituximab, fludarabine, mitoxantrone, and dexamethasone. Semin Oncol. 2002;29(1 suppl 2): 4855. 27. Pallisgaard N, Clausen N, Schroder H, Hokland P. Rapid and sensitive minimal residual disease detection in acute leukemia by quantitative realtime RT-PCR exemplified by t(12;21) TEL-AML1 fusion transcript. Genes Chromosomes Cancer. 1999;26(4):355365. 28. Bogadi-Sare A, Zavalic M, Trosic I, Turk R, Kontosic I, Jelcic I. Study of some immunological parameters in workers occupationally exposed to benzene. Int Arch Occup Environ Health. 2000;73(6):397400. 29. Dolken L, Schuler F, Dolken G. Frequency of BCL-2/J(H) translocation in healthy males exposed to low-level radiation in comparison to agematched health controls. Blood. 2002;100(4):15131514. 30. Roulland S, Lebailly P, Lecluse Y, Heutte N, Nadel B, Gauduchon P. Long-term clonal persistence and evolution of t(14;18)-bearing B cells in healthy individuals. Leukemia. 2006;20(1):158162. 31. Giannelli F, Moscarella S, Giannini C, et al. Effect of antiviral treatment in patients with chronic HCV infection and t(14;18) translocation. Blood. 2003;102(4):11961201. 32. Baccarelli A, Hirt C, Pesatori AC, et al. (14;18) translocations in lymphocytes of healthy dioxin-exposed individuals from Seveso, Italy. Carcinogenesis. 2006;27(10):20012007. 33. Snyder R. Overview of the toxicology of benzene. J Toxicol Environ Health A. 2000;61(56):339346. 34. Yasukawa M, Bando S, Dolken G, et al. Low frequency of BCL-2/J(H) translocation in peripheral blood lymphocytes of healthy Japanese individuals. Blood. 2001;98(2):486488. 35. Aplan PD. Causes of oncogenic chromosomal translocation. Trends Genet. 2006;22(1):4655. Funding Supported by National Institutes of Health grants RO1ES06721, P42ES04705 and P30ES01896 to M. T. Smith. Journal of the National Cancer Institute Monographs, No. 39, 2008 77