Document M42erMbZyGXQwE74wNKOVm3B9
Page 1
'" lexis. lNexts
loflDOCUMENT
Copyright 2005 Elsevier Ltd All Rights Reserved Leukemia Research
(2006) 30 ELEUKR 7769-775
July 2006
SECTION: 769-775 Vol. 30 No.7 ISSN: 0145-2126
LENGTH: 4644 words
TITLE: Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French American British classifications
HISTORY: Received: September 2,2005; Revised: October 18, 2005; Accepted: October 21, 2005
AUTHORS: Richard D. Irons (a) (b) (c) (d) richard.irons@uchsc.edu; Xiaoqin Wang (a) (e); Sherilyn A. Gross (a) (c); Liming Bao (a) (f); John Ryder (d); Yan Chen (a); Hui Chen (a); Hengjuan Sun (a); Jue Zhou (a); Meirong Ji (e); Xinyu Du (g); Hua Fu (h); Guowei Lin (e) (a) Sino-US Joint Clinical and Molecular Laboratory, Fudan University, Shanghai, China (b) Institutes of Biomedical Sciences, Department of Pathology, Fudan University, Shanghai, China (c) Department of Pharmaceutical Sciences, School of Pharmacy, University of Colorado at Denver and Health Sciences Center, Campus Box C-238, 4200 East Ninth Avenue, CO 80262, USA (d) Department of Pathology, School of Medicine, University of Colorado at Denver and Health Sciences Center, CO, USA (e) Huashan Hospital, Fudan University, Shanghai, China (f) Division of Human Genetics, Cincinnati Children's Hospital Medical Center, University of Cincinnati College of Medicine, OH, USA (g) Shanghai Second Medical University, Shanghai, China (h) School of Public Health, Fudan University, Shanghai, China
BODY:
ABSTRACT
Page 2 Prevalence ofMDS subtypes in Shanghai; China: A comparison of the World Health Organization and French
American British classifications beukemia Research July 2006
The prevalence of subtypes of the myelodysplastic syndromes (MDS) was determined in a prospective series of 176
patients presenti..'lg at 28 Shanghai hospitals. Diagnosis was established in a
laboratory, analyzingmorphologic,
immunophenotypic, and cytogenetic data, using the World Health Organization (WHO) revised classification and
directly compared to the French American British (FAB) criteria. The median age at diagnosis for all cases was 53
years. There was a striking increase in the prevalence ofRCMD in younger patients relative to other subtypes (WHO).
The overall frequency of clonal cytogenetic abnormalities was 26.5% (WHO) and 31 % (FAB). The most frequently
encountered lesions were trisomy 8, del(20)q, del(7q), and del(5q). These results are consistent with previously reported
age-dependent differences in MDS and a decreased frequency of del(5q) abnormalities between China and the West.
These results also indicate that multilineage dysplasia is a prominent feature in MDS developing in younger individuals
in Shanghai and
distinguishing between RCMD and RA may be important in the design of studies to further
understand regional differences in subtype prevalence and to elucidate the pathogenesis of this complex and
multifactorial disease.
.
FULL TEXT
1 Introduction
Myelodysplastic syndromes (MDS) are a heterogeneous group of diseases characterized by ineffective hematopoiesis and abnormal hematopoietic eell morphology, in one or more hematopoietic lineages, and a tendency of progression to bone marrow failure or acute myelogenous leukemia (AML). A central premise in the diagnosis and classification ofMDS is the presence of dysplasia in one or more hematopoietic lineages, althougt'1 other features, such as anemia, cytopenia, bone marrow cellularity, arid blast cell count are variously weighted in subtyping the disease. Several reports have suggested an increasing incidence of MDS over the past decade; however, these observations are tempered by difficulties in assessing and discriminating between regional variations in prevalence, differences in classification, the increasing frequency of diagnosis and differences in the invasiveness or sophistication of diagnostic procedures commonly employed [1]. These problems have been further accentuated by the fact that the distinction of MDS as a clinical and nosologic entity, which began with French American British (FAB) classification in.1982 [2], has been evolving over the past 20 years and has only recently been recognized to be part of the same spectrum of neoplastic diseases as the acute myeloid leukemias [3].
The FAB classification places MDS into a single diagnostic franlework, primarily on the basis of blast cell count,
presence or absence of ringed sideroblasts (RS) and peripheral blood monocyte count, as refractory anemia (RA),
refractory anemia with ringed sideroblasts (RARS), refractory anemia with excess blasts (RAEB), refractory anemia
with excess blasts in transformation (RAEBT), and chronic myelomonocyticleukemia (CMML). The FAB further
distinguishes AML, also primarily on the basis of blast cell count, bone marrow and peripheral blood cellularity as well
as lineage involvement [2,4], The recent World Health Organization (WHO) proposal is an attempt to improve the
diagnostic and prognostic utility ofMDS subclassification. The evolving clinical experience with the WHO
classification
which has been the subject of ongoing debate [5,6], has recently been reviewed [7,8]. The WHO
proposal differs in several aspects from the FAB system that include: (I) the cut-off rate for the number ofblast cells in
the bone marrow necessary to define AML, which traditionally in FAB has been 30% and is 20% in WHO, and (2) the
creation of a new subcategory, "refractory cytopenia with multilineage dysplasia (RCMD)", which distiriguishes
dysplasia occurring in a single cell lineage (e.g" erythroid) (Le., RA) from multilineage dysplasia involving two or more
lineages (Le., RCMD) in the absence of an increase in peripheral blood or bone marrow blasts. The reduction in blast
cell threshold for classification of AML has the effect of eliminating the FAB subcategory, RAEBT. The addition of
RCMD as a category emphasizes the importance of multilineage dysplasia independent of increased blasts which
appears to be of prognostic importance [9].
Chen et a1. recently reported the results of a retrospective study ofMDS which highlighted differences in the age of onset and prevalence ofMDS subtypes between Chinese and Western populations diagnosed according to the FAB criteria [10]. We report the results of a concurrent analysis of clinical, morphologic, and karyotypic features of an unselected series of 176 cases of de novo MDS diagnosed in patients at Shanghai hospitals. These cases were diagnosed
Page 3 Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifrcations Leukemia Research July 2006
according to the WHO classification and results directly compared with those obtained using FAB criteria.
2 Patients, materials, and methods
2.1 Case definitions
All patients, >= 18 years of age, presenting at 28 Shanghai hospitals with initial clinical fmdings consistent with a hematopoietic abnormality between August, 2003 and February, 2005 were candidates for inclusion in this study. Informed consent was obtained according to the Declaration of Helsinki, 2004 and the NIH Common Rule (4SCFR46), and together with the protocol, were approved by the Combined Institutional Review Board of the University of Colorado Health Sciences Center in Denver, Colorado and the Internal Review Board at Fudan University in Shanghai, China. Peripheral blood, bone marrow aspirates, and core biopsies were obtained on all individuals using standardized procedures and evaluated in our laboratory using morphologic, immunophenotypic, molecular, and cytogenetic techniques. MDS cases were initially classified according to the WHO as well as the traditional FAB classification systems [2]. Cases of CMML, which are classified as myelodysplastic/myeloproliferative diseases in WHO and as MDS under FAB, were included for comparison purposes. The requisite blast cell percentage for a diagnosis of AML in Shanghai is >=20%. For the purpose of comparison in this study, cases of AML originally diagnosed with blast cell percentages between 20% and 29% were reclassified as RAEBT according to FAB and compared with those classified according to WHO. Patients presenting with concomitant nutritional deficiencies (Vitamin B 12, folate, or iron), congenital anemias, viral (including HCV or HIV) or bacterial infections, occupational exposure to benzene or receiving cytotoxic therapy with alkylating or anti-metabolic agents were excluded in this analysis.
2.2 Peripheral blood
Blood samples were collected by venipuncture and processed for routine complete blood count (CBC) (CellDyne 3700, Abbott, Park, IL), viral screen (HCV and HIV) (Imx, Abbott, Park, IL) and clinical chemistry for liver enzymes (LDH, ALT, an.d AST enzymes) (COBAS, Integra 400 plus, Roche Diagnostics, Shanghai, China). Vitamin B12 and folate were measured by chemical luminescence (Beckman Coulter Dxi800), and total iron binding capacity was measured using a Beckman Coulter LX20. Peripheral blood smears were made from finger sticks.
2.3 Bone marrow
Bone marrow aspirates and core biopsies were obtained by needle extraction (Jamshidi) from the posterior iliac crest. Aspirate cell suspensions where stained with fluorochrome-conjugated antibodies for flow cytometric analysis of bone marrow cellular subsets. Multiparameter analysis was performed using a dual laser flow cytometer (FC-SOO, Beckman Coulter, Hialeah, FL; Immunotech, Miami, FL) equipped with compensation software (Software CXP, Beckman Coulter). A broad panel of antibodies was used for immunophenotyping of bone marrow cells that included CD4 and CD8. (Beckman Coulter, Immunotech). Morphology and immunophenotype analysis were conducted on both bone marrow aspirate (flow cytometry) and core biopsy (immunohistochemistry) material. Bone marrow aspirate smears were prepared from fresh tissue and evaluated using Wright-Giemsa stained preparations and special stains, including an iron stain. Core biopsy sections were evaluated using sections stained with hematoxylin-eosin, Gomori trichrome, and immunoperoxidase-immunohistochemistry.
2.4 Morphologic analysis
Morphologic diagnoses were subjected to a minimum of two and usually three levels of review. Peripheral blood and bone marrow smears and core biopsy slides were evaluated by two out of three of us (lM, X.D., R.D.I.), and independently reviewed by one or two of us (R.D.I., lR.). The tpreshold for lineage involvement was defined as a minimum of 10% of the cells of a given lineage exhibiting dysplastic changes. Dyserythropoiesis was defined by abnormal nuclear morphology, including internuclear bridging, abnormal budding, multiple nucleoli, and abnormal mitotic figures or megaloblastoid features. Myeloid or granulocytic dysplasia was defined by nuclear hypolobulation as observed in pseudo-Pelger Huet cells, hypersegmentation, abnormal mitotic forms, either hypo- or hyper-granulation of
Page 4 Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifications Leukemia Research July 2006
the cytoplasm as well as the presence of large irregular granules. Megakaryocyte dysplasia was defmed by hypo-lobulated, hyper-lobulated or non-lobulated nuclei, multiple nuclei, prematurely segmented or "shedding" cytoplasm or the presence of micromegakaryocytes in the bone marrow or peripheral blood. Microscopic apalysis was performed using an Olympus BX51 bright field microscope (Olympus Optical, Ltd., Tokyo, Japan).
All cases were evaluated for RS and iron utilization by morphologic examination of an iron stain. In practice, it is often difficult to distinguish between abnormal iron utilization and iron deficiency on the basis of the bone marrow iron stain alone-a problem that is exacerbated by the relative paucity ofRS in the majority of our MDS cases. Simiiarly, prominent megaloblastic features are often encountered in both MDS as well as folate, iron-folate, and Vitamin B 12 deficiencies. Therefore, nutritional deficiencies were independently determined by serum clinical chemistry, and patients with demonstrable deficiencies were excluded from this series.
Myelodysplastic syndrome-unclassifiable (MDS-u) is defined by WHO as MDS lacking findings appropriate for classification as RA, RARS, RCMD, or RAEB and in which blast cells are not increased. We restricted the use of MDS-u to those cases with features that did not meet either the narrow definition ofRA (i.e., dysplasia involving only the erythroid lineage), or RCMD (i.e., lacking sufficient evidence of dyserythropoiesis but exhibiting dysplasia in the other two lineages). A total of nine cases fulfilled these criteria for classification as MDS-u, of which seven were hypocellular. Using the FAB criteria, eight ofthe MDS-u cases would be classified as RA. It is widely appreciated that the differential diagnosis of severely hypoplastic disease as aplastic anemia (AA) or hypoplastic MDS is fraught with difficulty and remains problematic. The use ofMDS-u serves to identifY cases with evidence of dysplasia but with minimal or inconsistent findings to support further classification.
2.5 Cytogenetic and fluorescence in situ hybridization analysis
Cytogenetic analyses were performed on unstimulated bone marrow cells fonowing culture. Unstimulated bone marrow or peripheral blood cells were cultured for 24-72h, and G-banding analysis performed according to standard techniques. If possible, 20 metaphases were analyzed. Fluorescence in situ hybridization (FISH) analysis was performed on short-term cultures of bone marrow or blood cells. Sample preparation and hybridization were performed according to manufacturer's recommendations (Vysis, Downers Grove, 11). Images were viewed using Olympus fluorescence microscopes (Olympus Optical, Tokyo) equipped with appropriate filters and a PowerGene Macprobe image system (Applied Imaging International, Newcastle, UK). Systematic screening for del(5q), del(7q), and 11q23/MLL rearrangements was performed on each case. In some cases, additional FISH studies were used to either characterize abnormalities observed in banded studies or confirm the presence of cytogenetic aberrations when suggested by other diagnostic work-up. A minimum of 500 cells and 10 metaphases were scored in interphase and metaphase analysis, respectively_ All probes used in the FISH analyses were commercially purchased from Vysis (Downers Grove, IL).
2.6 Statistical analys-is
The [chiP, Fisher's exact and Kruskal-Wallis tests were used to examine differences between MDS subtypes employing STATA 8.0 software (StataCorp, College Station, Texas). All P-values were two-sided and values less than 0.05 were considered statistically significant.
3 Results
The total number of cases ofMDS diagnosed according to \\THO was 176, including 101 males (57%) and 75 females (43%). The prevalence ofWHO subtypes was: RA: 16 (9%), RARS: 1 (0.5%), RCMD: 122 (69.5%), RAEB: 28 (16%), and MDS-u: 9 (5%). The total number ofMDS subtypes diagnosed according to FAB (218 cases) was greater' than iJsing \VHO (176 cases), in part due to the inclusion ofCMML (13 cases) as well as 28 cases ofRAEBT and 1 RAEB that met a threshold for diagnosis as AML under lHO (Table 1). The majority of RCMD were reclassified as RA or RARS using FAB criteria. Seven cases ofRCMD and one case ofRA (WHO) met a threshold for >;=15% RS, aU of which were classified as RARS (FAB). Eight of the MDS-u cases were classified as RA under FAB. All cases of
Page 5 Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifications Leukemia Research July 2006
AML diagnosed over the same period using WHO criteria that would be classified as RAEBT under FAB criteria were included for purposes of this comparison (Table 2). All had bone marrow blast cell counts less than 30%. Twenty had blast cell counts between 20% and 29%, one had a blast cell count less than 20% (i.e., acute erythroleukemia) and eight independently met criteria for diagnosis as AML with recurring cytogenetic abnormalities according to WHO (i.e., t(8;21), 11q23IMLL rearrangements). Taken together these represent a 20% increase in the number ofMDS cases using the FAB compared to WHO criteria. Our findings are consistent with previously repOlied decreases in the prevalence of CMML and RARS in Asian populations [10-14].
The overall median age for MDS was 53 years (range 19-82) with 25% ofthe cases <=40 years of age (Fig. 1). In general, cases of RCMD (WHO) demonstrated the largest prevalence in this series independent of age. However, RCMD showed a significant difference in age-dependent frequency in the early age group (second decade) ([chiP 92.21, P=O.OOOI). With the possible exception of platelets, individual bone marrow and peripheral blood parameters did not vary across MDS subtypes diagnosed according to WHO, and none were statistically significant (Table 3), The diagnosis of RCMD requires scoring a minimum of 10% dysplastic changes in two or more myeloid lineages; however, in the majority of these cases the degree of dysplasia was marked.
1. Age-distribution ofMDS subtypes according to W110 in patients grouped by decades. The age-distribution of MDS subtypes is plotted as the percent of total MDS. (*) A higher prevalence ofRCMD was observed in all decades relative to other subtypes, but was significant only in the <=29 year age group (P=O,OOOl).
G-banded chromosome analysis was completed in 163 of 176 total MDS cases diagnosed according to WHO
(92,6%) (Table 4). One case for which conventional cytogenetic analysis was not completed was demonstrated to have
clonal abnonnalities by FISH. Therefore, informative cytogenetic data was obtained from 164 of 176 patients (93.2%).
Among those, 43 cases (26.2%) had clonal abnormalities. The most frequently observed chromosome abnormalities
were trisomy 8 (20 cases, 12.2%), del(7q) (8 cases, 4.9%), del(20q) (7 cases, 4.3%), and del(5q) (4 cases, 2.4%) (Table
5). Translocations, each of which was unique, were observed in seven cases (i.e., 3 RCMD, 3
and 1 MDS-u)
with a median age of 63.3 years. A complex karyotype, defmed as more than two independent chromosome aberrations,
was detected in eight cases (4.90%). Using the defmitions outlined by the International Prognostic Scoring System
(IPSS) [15], eases with good, intermediate and poor cytogenetic risk features were observed in 76.6%, 12.9%, and
10.4% of patients, respectively. No eases ofMDS with del(5q) as the sole abnormality were observed. The highest
frequency of clonal cytogenetic abnormalities was found in eases with RAEB (40.7%), followed by MDS-u (37.5%),
RCMD (24.6%), and RA (7.1%). Using case definitions for MDS as defined by FAB, 64 cases (31%) had clonal
abnormalities.
4 Discussion
Characterization of clonal cytogenetic abnormalities has proven to be important in evaluating prognosis in MDS. However, there is only limited retrospective data on the MDS subtype distribution of cytogenetic abnormalities diagnosed according to WHO [10,11]. The frequency of aberrations in de novo MDS (FAB) has been previously reported to be 35-40% [10,11,16,17]. In this prospective analysis, clonal abnormali-qes were detected in 26.2% ofMDS cases diagnosed according to WHO as compared to 31 % diagnosed using FAB criteria. This not withstanding, informative cytogenetic data was available in more than 93% of our patients, which is significantly higher than 40-70% reported in most MDS (FAB) studies [10,11,18-21]. Differences in the frequency of clonal aberrations between our series and previous reports in large part can be attributed to differences in the WHO and FAB MDS classification
Page 6 Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifications Leukemia Research July 2006
criteria. Cases ofRAEBT (FAB), which are
as AML using WHO criteria, and therefore not Classified as
MDS, usually have a high frequency of chromosome abnormalities [10,11,16,17]. Further, cases diagnosed as MDS
(FAB) with t [8,21] and 1Iq23/MLL rearrangements are diagnosed as AML according tq WHO [22].
Cytogenetic abnormalities most commonly described in MDS in the West include (in the order of frequency) del(5q), del(7q), ';-8, and del(20q) [23J. Several studies, including ours, indicate that trisomy 8 is the most common cytogenetic abnormality in Asian MDS. However, inconsistent results are reported for the prevalence of del(5q), del(7q), and del(20q) [10-12,17,24]. In a retrospective study of Chinese MDS patients diagnosed according to FAB, Chen and colleagues reported the frequencies of del(5q) and del(7q) as 4.6% and 1.6%, respectively [10]. Our findings suggest that Asian patients more frequently present with del(7q) than del(5q) abnormalities, and that the frequency of del(5q) abnormalities is lower than in the WesLIt is possible that this may be related to the younger median age of MDS cases in Asian versus Western populations. Similar results also have been reported for Japanese patients by Toyama et al. [24] and Matsushima et al. [17] for overall MDS and by Matsuda et al. for RA [25]. According to IPSS, karyotype at diagnosis is an independent prognostic factor to predict survival and leulcemic progression in MDS [15J. The frequency of karyotypes in RCMD in our study that are associated with a poor prognosis is low (7.9%) compared to 20% reported by Matsuda in a Japanese population with similar median age The reason for these differences is not immediately apparent. Using the same criteria, our cases showed frequencies among overall WHO MDS patients that are comparable to other studies (good risk: 76.6%, intermediate risk: 12.9%, and poor risk: 10.4%) [11,15]. Follow-up studies are ongoing to determine if the cytogenetic features defined by IPSS also predict risk in overall MDS or subtypes classified according to WHO.
Our results are consistent with studies that have reported a much younger age of onset for MDS, as well as a lower
prevalence ofRS and CMML in Asian popUlations relative to those found in the West [1,10-14]. The most striking
observations in our patients were the increased prevalence of multilineage dysplasia together with the number of cases
presenting at an early age. In contrast to other subtypes ofMDS in which there is a tendency toward increased
frequency with advancing age, cases ofRCMD were often encountered in patients 19-29 years old, and the increased
frequency of RCMD in this age group relative to total MDS or the other individual subtypes, such as RAEB or RARS is
highly significant (P<=40 years of age (Fig. 1). In general, cases ofRCMD (WHO) demonstrated the largest prevalence
in this series independent ofage. However, RCMD showed a significant difference in age-dependent frequency in the
early age group (second decade) ([chi]2 92.21, P=O.OOOI). With the possible exception of platelets, individual bone
marrow and peripheral blood parameters did not vary across MDS subtypes diagnosed according to WHO, and none
were statistically significant (Table 3). The diagnosis of RCMD requires scoring a minimum of )0% dysplastic changes
in two or more myeloid lineages; however, in the majority of these cases the degree of dysplasia was marked.Fig. 1.
Age-distribution ofMDS subtypes according to WHO in patients grouped by decades. The age-distribution ofMDS
subtypes is plotted as the percent of total MDS. (*) A higher prevalence ofRCMD was observed in all decades relative
to other subtypes, but was significant only in the <=29 year age group (P=O.OOO 1). G-banded chromosome analysis was
completed in 163 of 176 total MDS cases diagnosed according to WHO (92.6%) (Table 4). One case for which
conventional cytogenetic analysis was not completed was demonstrated to have clonal abnormalities by FISH.
Therefore, informative cytogenetic data was obtained from 164 of 176 patients (93.2%). Among those, 43 cases (26.2%)
had clonal abnormalities. The most frequently observed chromosome abnornlalities were trisomy 8 (20 cases, 12.2%),
de1(7q) (8 cases, 4.9%), del(20q) (7 cases, 4.3%), and del(5q) (4 cases, 2.4%) (Table 5). Translocations, each of which
was unique, were observed in seven cases (i.e., 3 RCMD, 3 RAEB, and 1 MDS-u) with a median age of 63.3 years. A
complex karyotype, defined as more than two independent chromosome
was detected in eight cases
(4.90%). Using the definitions outlined by the International Prognostic Scoring System (IPSS) [15], cases with good,
intermediate and poor cytogenetic risk features were observed in 76.6%,12.9%, and 1004% of patients, respectively. No
cases ofMDS with del(5q) as the sole abnormality were observed. The highest frequency of clonal cytogenetic
abnormalities was found in cases with RAEB (40.7%), followed by MDS-u (37.5%), RCMD {24.6%), and RA (7.1 %).
Using case definitions for MDS as defined by FAB, 64 cases (31 %) had clonal abnormalitiesA
DiscussionCharacterization of clonal cytogenetic abnonnalities has proven to be important in evaluating prognosis in
MDS. However, there is only limited retrospective data on the MDS subtype distribution of cytogenetic abnormalities
Page 7
Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French ,.;",' American British classifications Leukemia Research July 2006
diagnosed according to WHO [10,11]. The frequency of aberrations in de novo MDS (FAB) has been previously
reported to be 35-40% [10,11,16,17]. In this prospective analysis, clonal abnormalities were detected in 26.2% ofMDS
cases diagnosed according to WHO as compared to 31 % diagnosed using
This not withstanding,
informative cytogenetic data was available in more than 93% of our patients, which is significantly higher than 40-70%
reported in most MDS (Fi\.B) studies [10,11,18-21]. Differences in the frequency of clonal aberrations between our
series and previous reports in large part can be attributed to differences in the WHO and FAB MDS classification
criteria. Cases of RAEBT (FAB), which are diagnosed as AML using WHO criteria, and therefore not classified as
MDS, usually have a high frequency of chromosome abnormalities [10,11,16,17]. Further, cases diagnosed as MDS
(FAB) with t [8,21] and llq23/MLL reanangements are diagnosed as AML according to WHO [22].Cytogenetic
abnormalities most commonly described in MDS in the West include (in the order of frequency) del(Sq), del(7q), +8,
and del(20q) [23]. Several studies, including ours, indicate that trisomy 8 is the most common cytogenetic abnormality
in Asian MDS, However, inconsistent results are reported for the prevalence of del(Sq), del(7q), and del(20q)
[l 0-12, 17,24]. In a retrospective study of Chinese MDS patients diagnosed according to FAB, Chen and colleagues
reported the frequencies of del(Sq) and del(7q) as 4.6% and 1.6%, respectively [10]. Our findings suggest that Asian
patients more frequently present with del(7q) than de1(Sq) abnormalities, and that the frequency of del(Sq) abnormalities
is lower than in the West. It is possible that this may be related to the younger median age ofMDS cases in Asian
versus Western populations. Similar results also have been reported for Japanese patients by Toyama et al. [24J and
Matsushima et aL [17] for overall MDS and by Matsuda et aL for RA [2S]. According to IPSS,
at diagnosis is
an independent prognostic factor to predict survival and leukemic progression in MDS [IS]. The frequency of
karyotypes in RCMD in our study that are associated with a poor prognosis is low (7.90j,j) compared to 20% reported by
Matsuda in a Japanese population with similar median age [2S]. The reason for these differences is not immediately
apparent. Using the same criteria, our cases showed frequencies among overall WHO MDS patients that are comparable
to other studies (good risk: 76.6%, intermediate risk: 12.9%, and poor risk: 10.4%) [l1,lS]. Follow-up studies are
ongoing to determine if the cytogenetic features defIned by IPSS also predict risk in overall MDS or subtypes ciassified
according to WHO.Our results are consistent with studies that have reported a much younger age of onset for MDS, as
well as a lower prevalence ofRS and CMML in Asiful populations relative to those found in the West [1,10-14]. The
most striking observations in our patients were the increased prevalence of multilineage dysplasia together with the
number of cases presenting at an early age. In contrast to other subtypes ofMDS in which there is a tendency toward
increased frequency with advancing age, cases ofRCMD were often encountered in patients 19-29 years old, and the
increased frequency ofRCMD in this age group relative to total MDS or the other individual subtypes, such as RAEB
or RARS is highly significant (P<O.OOOOl). The increase in frequency ofRCMD relative to RAEB probably accounts
for the decreased numbers ofRAEB in this series. However, the remarkably low frequency ofRS remains unexplained.
Cases of childhood MDS, independent of defined congenital hematologic disorders, have been recognized in the West
[26].
neither the origins of the disease nor its clinical significance in such a yoUng age group are understood.
It is that the prevalence of childhood AML in Shanghai is more than twice that reported in the West [27].
Whether there is a biological link between the development of childhood AML and the frequency of multilineage
dysplasia in young adults in Shanghai remains unexplored. However, there are a number of factors that could possibly
influence the development of MDS in general and multilineage dysplasia specifically. Nutritional factors are well
known to playa role in the development of anemias. A total of 44 cases were excluded from our series due to
confounding by deficiencies involving iron, folate, and Vitamin B 12 either singly or in combination. These findings
suggest that the frequency of anemia attributable to nutritional deficiency is relatively high in Shanghai and surrounding
areas and is an important complicating factor in the evaluation of regional hematopoietic disease.
It previously has been suggested that regional differences in subtype-specific survival might contribute to artifacts in the prevalence of MDS subtypes and age-distribution. However, it is unlikely that these influences could explain the magnitude of disparity observed in this series, and the trend toward RCMD in a younger age group is more likely to be the result of differences in the etiology and/or pathogenesis of individual MDS subtypes. Chen et al. have suggested that differences in.the age-dependence ofMDS occurring in Asian popUlations may be explained by exposure to environmental factors including chemicals and infectious agents [i 0). However, in our series we excluded 30 cases of MDS with known previous exposure to benzene or alkylating chemotherapy. The features of dysplasia developing in
Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French American British classifications Leukemia Research July 2006
8
individuals with previous evidence of benzene poisoning appears to have a discrete clinicopathologic signature that is
useful in distinguishing benzene-induced persistent dysplasia from previously characterized forms of MDS [28].
Nevertheless, environmental or dietary exposure to chemicals remains, an important question with respect to their
potentiaLinfluence on the prevalence and age-dependcnce ofRCMD in our patients. Moreover, the role of infectious
agents in the development of MDS is largely unexplored and may be of importance in light of the fact that a
deal
of evidence has emerg,ed to implicate a role for altered immune regulation in the pathogenesis of MDS [29-32]. Finally,
the role of genetic polymorprusms that may impact on the susceptibility of developing MDS in this population is
unknown. Any ofthese factors, either singly or in combination, might influence the pathogenesis ofMDS. However, at
present their role in explaining these results remains undetermined. Our results provide a basis for direct comparison of
WHO and FAB criteria in the differential diagnosis ofMDS and further identify a marked predisposition toward
multilineage dysplasia at a young age in this Asian population. Follow-up ofthese cases will provide further insight into
the role of dysplastic changes in the etiology and pathogenesis ofMDS as well as provide a basis for the continuing
evaluation of the clinical and biological significance ofthe WHO diagnostic paradigm.
Acknowledgments
This study was funded by a grant from the Benzene Health Research Consortium and was conducted in cooperation
with the Shanghai Hematology and Pathology Societies. We would like to thank the patients and the physicians who
participated in our study. The participating hospitals included Huashan Hospital, Xinhua Hospital, Long March
Hospital, Huang Pu Central Distract Hospital, Renji Hospital, Ruijin Hospital, Huadong Hospital, Jin An Central
Hospital, No. I People's Hospital, No.5 People's Hospital, No.6 People's Hospital, No.9 People's Hospital, Yang Pu
Central Hospital, Zha Bei Central Hospital, Shu Guang Hospital, Chang Ning Central Hospital,
Ji Hospital, Shong
Jin Central Hospital, Zhong Shan Hospital, Railway Hospital, Rong Hua Hospital, Changhai Hospital, Occupational
Disease Hospital, Jiading Central Hospital, 455 Hospital, Shidong Hospital, No.1 Baoshan Hospital, and Putuo Central
Hospital. We would also like to extend appreciation to Allan Holsomback, Deqiang Ouyang, and Anh Le for database
management and Aml Louden, Junfang Xie, and Jiamin Liu for manuscript and clerical assistance.
TABLES
Table 1 Comparison of WHO and FAB diagnostic criteria in MDS subtypes MDS(WHO)
RA RARS RAEB RCMD MDS-u
Total cases
16 (9%)
J(0.5%)
28 (16%) 122 (69.5%) 9 (5%)
MDS (FAB) RA RARS RAEB RAEBT CMML
Total cases
140 (64.2%) 8 (3.6%) 29 (13.3%) 28 (12.8%) 13 (5.9%)
Total Re-evaluation of WHO MDS by FAB
176
Total
218
Table 2
Page 9 Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifications Leukemia Research July 2006
Comparison of WHO and FAB diagnostic criteria in cases of AML .A.ML{WHO) AML not otherwise categorized AML with reCUlTent cytogenetic abnonnalities AML with muitilineage dysplasia Acute erythroid leukemiaa
aBlasts=22% of non-erythroid.
N Blasts (%) 10 20-27 8 21-29 1020-25.5 1 11
MDS (FAB)
RAEBT RAEBT RAEBT Jt.A..EB
Table 3 MD Hematologic and immune parameters in paS tients diagnosed with MDS according to WHO (W criteria HO)
Bone marrow (BM) cellularity
Hyper
Bone marrow ]ymphocytes
Normo
Periphera] blood
Hypo %Lym CD4: WBC HgB PLT ph CDS xlO9L (gldL)
xlO
Page 10 Prevalence ofMDS subtypes iIi Shanghai, China: A comparison ofthe World Health Organization and French
American British classifications Leukemia Research July 2006
MD 88 (50%) S total RA 10 (62%)
RA 1 (100%) RS RA 17 (60%) EB
RC 58 (47%) MD
MD 2 (22%) S-u
9L
28 (16%) 57
21.7 1.1 2.62 7.68 80
(32%) (1.0-82. (0.1-5 (0.52-1 (2.71-1 (1.9-
6) .7) 0.6) 5.5) 468)
3 (18%)
3 20.9 1.2 2.89 7.55 119 (18%) (3.1-54. (0.1-4 (1.75-7. (4.17-1 (5.7-
9) .1) 82) 2.2) 393)
0 0 2.8 0.8 4.50 7.58 335
3 (10%) 22 (18%) 0
7 (25%)
40 (32%)
7 (77%)
26.6 1.0 2.73 6.82 60 (1.9-63. (0.3-2 (0.76-1 (3.71-1 (1.93) .2) 0.6) 1.3) 260)
20.9 1.2 2.40 7.84 78 (1.0-82. (0.2-5 (0.52-6. (2.71-1 (4.56) .7) 75) 4.3) 468)
21.0 1.1 2.14 8.42 98 (7.7-33. (0.2-1 (0.54-5. (3.93-1 (5.75) .7) 39) 5.5) 395)
Clinical observations in MDS subjects diagnosed by WHO criteria
Bone marrow cellularity was estimated from the trephine core biopsy (hypo, hypoplastic [<40% cellularity];
normo, normal [40-60% cellularity]; and hyper-hyperplastic [>60% cellularity]. Lymphocytes in BM aspirates: %
lymph, % lymphocytes; CD4:CD8, ratio determined by flow cytometry in BM aspirate cells. Reference ranges in Shanghai: WBC (4-10 x IQ9L-1); Hgb (12-l6g/dL), PLT (l00-300 x109L-1).
Table 4 Cytogenetic analysis of MDS subtypes MDS subtypes
RA RARS RAEB RCMD MDS-u
Total cases
16 1 28 122
9
No. complete cytogenetic ana- Total percentage of abnormal lysis cases 14 1 (7.1 %)
10 '27 11 (40.7%) 114 28G (24.6%) 7 3b (37.5%)
Total
176 163 (92.6%)
Analysis in MDS cases by standard cytogenetic criteria aOne case with extra Y. bOne case with informative FISH without cytogenetic data.
43 (26.2%)
Page II Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifications Leukemia Research July 2006
Table 5 Clonal cytogenetic abnormalities in MDS subtypes
Clonal abnormality (Abnl)
No.ofabnormality
del(Sq)
4
del(7q)
8
Trisomy 8
20
del(20q)
7
Monosomy 21
del(9q)
2
Complex karyotype >=3 Abnl
8
%Informat RA (14) RAEB (27) RCMD (114) MDS-u (7) ive (164)
2.4
0
2 (7.4%) 2 (1.7%)
0
4.9
0
3 (11.1 %) 4 (3.S%)
la
12.2 6 (22.2%) 13 (11.4%) 0
4.3
0
I (3.7%) 6 (S.3%)
0
0.6 0 1(3.7%) 0
0
1.2
0
I (3.7%) I (0.9%)
0
4.9
0
3 (11.1%) S (4.4%)
0
Frequency of abnornlal cytogenetics in MDS cases in Shanghai aOne case with informative FISH without cytogenetic data.
REFERENCES:
[I]. C. Aul, U. Germing, N. Gattermann, H. Minning; Increasing incidence ofmyelodysplastic syndromes: real or fictitious?; Leuk Res; Vol. 22, (1998), pp. 93-100.
[2]. J.M. Bennett, D. Catovsky, M.T. Daniel, G. Flandrin, D.A.G. Galton, H.R. Gralnick, et al.; Proposals for the classification of the myelodysplastic syndromes; Br J Haematol; Vol. SI, (1982), pp. 189-199.
[3]. B.D. Cheson, J.M. Bennett, H. Kantarjian, A. Pinto, C.A. Schiffer, S.D. Nimer, et al.; Report of an international working group to standardize response criteria for myelodysplastic syndromes; Blood; Vol. 96, (2000), pp. 3671-3674.
[4]. Classification of acute leukemia. Ann Intern Med 1977;87:740-53.
[5]. E. Jaffe, N. Harris, H. Stein, l Vardiman; P. Kleihues, L.H. Sobin Editors; World Health Organization classification of tumours. Pathology and genetics of tumours ofhaematopoietic and lymphoid tissues; IARC Press, Lyon, France (2001),.
[6]. U. Germing, N. Gattermann, C. Strupp, M. Aivado, C. Aul; Validation of the WHO proposals for a new classification of primary myelodysplastic syndromes: a retrospective analysis of 1600 patients; Leuk Res; Vol. 24, (2000), pp. 983-992.
[7]. -300x 109L-I).Table 4Cytogenetic analysis ofMDS subtypesMDS subtypesTotal casesNo. complete cytogenetic analysisTotal percentage of abnormal casesRA16141 (7.1 %)RARSIIORAEB282711 (40.7%)RCMD12211428a (24.6%)MDS-u973b (37.S%)Tota1176163 (92.6%)43 (26.2%)Analysis in MDS cases by standard cytogenetic criteriaaOne case with extra Y.bOne case with informative FISH without cytogenetic data. Table SClonal cytogenetic abnormalities in MDS subtypesClonal abnormality (Abnl)No. of abnormality%Informative (164)RA (14)RAEB (27)RCMD (114)MDS-u (7)del(Sq)42.402 (7.4%)2 (1.7%)Odel(7q)84.903 (11.1%)4 (3.5%)laTrisomy 82012.216 (22.2%)13 (11.4%)Odel(20q)74.301 (3.7%)6 (S.3%)OMonosomy 2110.601 (3.7%)00del(9q)21.201 (3.7%)1 (0.9%)OComplex karyotype >=3 AbnI84.903 (11.1 %)S (4.4%)OFrequency of abnormal
cytogenetics in MDS cases in ShanghaiaOne case with informative FISH without cytogenetic data.CONTACT: *
Corresponding author. Tel.: +1 303 3157170.[1]. C. Aul, U. Germing, N. Gattermann, H.Minning; Increasing
incidence ofmyelodysplastic syndromes: real or fictitious?; Leuk Res; Vol. 22, (1998), pp. 93-100.[2]. lM. Bennett,
Page 12 Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifications Leukemia Research July 2006
D. Catovsky, M.T. Daniel, G. Flandrin, D.A.G. Galton, H.R. Gralnick, et al.; Proposals for the classification of the
myelodysplastic syndromes; Br J Haematol; Vol. 51, (1982), pp. 189-199.[3]. B.D. Cheson, 1M. Bennett, H.
Kantarjian, A. Pinto, c.A. Sch,iffer, S.D. Nimer, et aL; Report of an international working group to standardize response
criteria for myelodysplastic syndromes; Blood; Vol. 96, (2000), pp. 3671-3674.[4]. Classificationof acute leukemia.
Ann Intern Med 1977;87:740-53.[5]. E. Jaffe, N.
H. Stein, J. Vardiman; P. Kleihues, L.H. Sobin Editors; World
Health Organization classification of tumours. Pathology and
of tumours ofhaematopoietic and lymphoid
tissues; IARC Press, Lyon, France (2001), .[6]. U. Germing, N. Gattermann, C. Strupp, M. Aivado, C. Aul; Validation
of the WHO proposals for a new classification of primary myelodysplastic syndromes: a retrospective analysis of 1600
patients; Leuk Res; Vol. 24, (2000), pp. 983-992.[7]. R.S. Komrokji, J.M. Bennett; The clinical implications of the
World Health Organization's classification ofmyelodysplastic syndromes; Curr Hematol Rep; Vol. 4, (2005), pp.
175-181.
[8].T. Nosslinger, R. Reisner, E. Koller, H. Gruner, H. Tuchler, H. Nowotny, et al.; Myelodysplastic syndromes, from French-American-British to World Health Organization: comparison of classifications on 431 unselected patients from a single institution; Blood; Vol. 98, (200 I), pp. 2935-2941.
[9]. R.B. Howe, A. Porwit-MacDonald, R. Wanat, R. Tehranchi, E. Hellstrom-Lindberg; The WHO classification ofMDS does make a difference; Blood; VoL 103, (2004), pp. 3265-3270.
[10]. B. Chen, W.L. Zhao, J. Jin, Y.Q. Xue, X. Cheng, X.T. Chen, et al.; Clinical and cytogenetic features of508 Chinese patients with myelodysplastic syndrome and comparison with those in Western countries; Leukemia; Vol. 19, (2005), pp. 767-775.
[11]. J.H. Lee, J.H. Lee, Y.R. Shin, J.S. Lee, W.K. Kim, H.S. Chi, et al.; Application of different prognostic scoring systems and comparison of the FAB and WHO classifications in Korean patients with myelodysplastic syndrome; Leukemia; Vol. 17, (2003), pp. 305-313.
[12]. D.S. Lee, S.H. Kim, EJ. Seo, C.l Park, H.S. Chi, E.K. Ko, et al.; Predominance of Trisomy lq in mye10dysplastic syndromes in Korea: is there an ethnic difference? A 3-year multi-centcr study; Cancer Genet Cytogenet; Vol. 132, (2002), pp. 97-101:
[13]. S. Oguma, Y. Yoshida,H. Uchino, T. Maekawa, t. Nomura, H. Mizoguchi; Clinical characteristics of
Japanese patientswith primary myelodysplastic syndromes: a co-operative study based on 838 cases. Anemia Study Group of the Ministry of Health and Welfare; Leuk Res; Vol. 19, (1995), pp. 219-225.
[14]. T. Intragumtornchai, W. Prayoonwiwat, D. Swasdikul, N. Suwanwela, B. Chaimongkol, S. Jootar, et al.; Myelodysplastic syndromes in Thailand: a retrospective pathologic and clinical analysis of 117 cases; Leuk Res; Vol. 22, (1998), pp. 453-460.
[15]. P. Greenberg, C. Cox, M.M. LeBeau, P. Fenaux, P. Morel, G.
et al.; International scoring system for
evaluating prognosis in myelodysplastic syndromes; Blood; Vol. 89, (1997), pp. 2079-2088.
[16]. S. Heim, F. Mitelman;Cancer cytogenetics; Wiley-Liss, New York (1995),.
[17]. T. Matsushima, H. Handa, A. Yokohama, J. Nagasaki, H. Koiso, Y.
al.; Prevalence and clinical
characteristics ofmyelodysplastic syndrome with bone marrow eosinophilia or basophilia; Blood; Vol. 101, (2003), pp.
3386-3390.
[18]. c.L. Balduini, R. Guarnone, A. Pecci, E. Centenara, R.
E. The myelodysplastic syndromes:
predictive value of eight prognostic systems in 143 cases froin a single institution; Haematologica; Vol. 84, (1999), pp.
12-16.
Page 13 Prevalence ofMDS subtypes in Shanghai, China: A comparison of the World Health Organization and French
American British classifications Leukemia Research July 2006
[19]. V. Parlier, G. van Melle, P. Beris, P.M. Schmidt, A. Tobler, E. Haller, et al.; Prediction of l8-month survival in patients with primary myelodysplastic syndrome. A regression model and scoring system based on the combination of chromosome findings and the Bournemouth score; Cancer Genet Cytogenet; Vol. 81, (1995), pp. 158-165.
[20]. F. Sole, B. Espinet, G.F. Sanz, J. Cervera, M.J. Calasanz, E. Luno, et al.; Incidence, characterization and prognostic significance of chromosomal abnormalities in 640 patients with primary myelodysplastic syndromes. Grupo Cooperativo Espanol De Citogenetica Hematologica; Br J Haematol; Vol. 108, (2000), pp. 346-356.
[21]. T. Vallespi, M. Imbert, C. Mecucci, C. Preudhomme, P. Fenaux; Diagnosis, classification, and cytogenetics of myelodysplastic syndromes; Haematologica; Vol. 83, (1998), pp. 258-275.
[22J. N.L. Harris, E.S. Jaffe, l Diebold, G. Flandrin, H.K. Muller-Hermelink, l Vardiman, et al.; World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting-Airlie House, Virginia, November 1997; J Clin Oncol; Vol. 17, (1999), pp. 3835-3849.
[23]. Standing Committee on Human Cytogenetic Nomenclature. An international system for human cytogenetic nomenclature (1995): recommendations of the international standing committee on human cytoge~etic nomenclature, Memphis, Tenn., October 1994. New York: Karger; 1995.
[24]. K. Toyama, K. Ohyashiki, Y. Yoshida, T. Abe, S. Asano, H. Hirai, et al.; Clinical implications of chromosomal abnormalities in 401 patients with myelodysplastic syndromes: a multicentric study in Japan; Leukemia; Vol. 7, (1993), pp. 499-508.
[25]. A. Matsuda, U. Germing, 1. Jinnai, M. Misumi, A. Kuendgen, S. Knipp, et al.; Difference in clinical features between Japanese and German patients with refractory anemia in myelodysplastic syndromes; Blood; Vol. 106, (2005), pp.2633-2640.
[26]. K. Mandel, Y. Dror, A. Poon, M.H. Freedman, A. Practical; Comprehensive classification for pediatric myelodysplastic syndromes: the CCC system; J Pediatr Hematol Oncol; Vol. 24, (2002),pp. 343-352.
[27]. X.O. Shu, Y.T. Gao, L.A. Brinton, M.S. Linet, J.T. Tu, W. Zheng, et al.; A population-based case-control study of childhood leukemia in Shanghai; Cancer; Vol. 62, (1988), pp. 635-644.
[28]. Irons RD, Lv L, Gross SA, Ye X, Bao L, Wang XQ, et al., Chronic exposure to benzene results in a unique fornl of dysplasia. Leuk Res, 2005;29: 1371-80.
[29]. A.I. Barrett; Myelodysplastic syndrome-an example of misguided immune surveillance?; Leuk Res; Vol. 28, (2004), pp. 1123-1124.
[30]. c. Rosenfeld"A. List; A hypothesis for the pathogenesis ofmyelodysplastic syndromes: implications for new
therapies; Leukemia; Vol. 14, (2000), pp. 2-8.
[31]. D.H. Biesma, lG. van den Tweel, L.F. Verdonck; Immunosuppressive therapy for hypoplastic myelodysplastic syndrome; Cancer; Vol. 79, (1997), pp. 1548-1551.
[32]. T. Matsutani, T. Yoshioka, Y. Tsuruta, T. Shimamoto, lH. Ohyashiki, R. Suzuki, et al.; Determination of T-cell receptors of clonal CD8-positive T-cells in myelodysplastic syndrome with erythroid hypoplasia; Leuk Res; Vol. 27, (2003), pp. 305-312.
LOAD-DATE: October 16,2008
Int J Hemalol (2008) 88:165-173 DOl 10.1007/512185-008-0132-1
A prospective study of 728 cases of non-Hodgkin lymphoma from a' single laboratory in Shanghai, China
Sherilyn A. Gross' Xiongzeng Zhu . Liming Bao . John Ryder' Anh Le . Van Chen' Xiao Qin Wang' Richard D. Irons
Received: 15 January 2008/Revised: 14 May 20081 Accepted: 16 June 2008/Published online: 23 July 2008
The Japanese Society of Hematology 2008
Abstract The frequency of sUbtypes of lymphoid neoplasms was determined in a prospective series of 831 patients presenting at 29 Shanghai hospitals over a 4-year period, Diagnosis and classification was established in a single laboratory according to the 2001 WHO classification system, The frequency of non-Hodgkin lymphoma was 87.6% (n 728) and Hodgkin lymphoma was 12.4%
(n = 103), The most prevalent NHL subtypes diagnosed
Present Address: S, A Gross' L, Bao Y, Chen' X, Q. Wang R. D. Irons Fudan-Cinpathogen Clinical and Molecular Research Center, Institutes of Biomedical Sciences, Fudan University, 130 Dong An Road, 200032 Shanghai, China
S. A Gross A. Le ' R, D, Irons Molecular Toxicology and Environmental Health Sciences Program, School of Pharmacy, University of Colorado Denver, Denver, CO, USA
X. Zhu Department of Pathology, Cancer Hospital, Fudan University, Shanghai, China
L. Bao Division of Human Genetics, Cincinnati Children's Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH, USA
1. Ryder' R. D. Irons Department of Pathology, School of Medicine, University of Colorado Denver, Denver, CO, USA
R, D. Irons Cinpathogen, Inc" Boulder. CO, USA e-mail: richard.irons@cinpathogen.com
R. D. Irons Cinpathogen, Inc., Shanghai, China
using WHO criteria were diffuse large B cell lymphoma (DLBCL), precursor B lymphoblastic leukemia/lymphoma and chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL). Although a low incidence has been reported in some Asian populations, CLLlSLL was commonly encountered, indicating that chronic lymphoid neoplasms are not rare in Shanghai. Consistent with previous reports, our findings indicate a decrease in the frequency of follicular lymphoma and an increase in T cell neoplasms compared to the West, Precursor T lymphoblastic leukemia/lymphoma, anaplastic large T cell lymphoma, aggressive NK cell leukemia, angioimmunoblastic T cell lymphoma and peripheral T cell lymphoma were prominent SUbtypes of T cell NHL.
Keywords Non-Hodgkin lymphoma 2001 WHO diagnostic criteria Prospective study
1 Introduction
Non-Hodgkin lymphoma (NHL) refers to more than two dozen distinct neoplastic diseases of the lymphoid system that involve the malignant outgrowth of B and T lymphocytes, The individual characteristics of different lymphomas are thought to result from the neoplastic transfonnation of different lymphocytic populations at different stages in their maturation and transfonnation [1], Over the last two decades, advances in knowledge of the biology of NHL have resulted in the development of an international consensus for the ,diagnosis and classification of NHL and its subtypes, The World Health Organization (WHO) Classification of Tumors of Hematopoietic and Lymphoid Tissues [2] was put forth in 2001 in order to provide unifonn diagnostic criteria for NHL subtypes on
~Springer
166 S. A. Gross et al.
the basis of morphology, immunophenotype, cytogenetics, pathogenesis and clinical characteristics. The WHO classification is based on and extends the 1994 Revised European American Lymphoma (REAL) classification system [3]. The WHO classification recognizes three major categories of lymphoid neoplasms: B cell neoplasms, T and NK cell neoplasms and Hodgkin lymphoma. However, in contrast to REAL, lymphoid leukemias also are included in the WHO classification which stratifies lymphoid neoplasms on the basis of cellular origin and biology [2].
To date, the use of the WHO classification in studies of NHL in China have been limited by the lack of uniform access to the diagnostic tools (e.g., immunohistochemistry, cytogenetics, fluorescence in situ hybridization (FISH)) required to meet WHO criteria. Reports from previous epidemiologic studies using the REAL classification system have indicated significant differences in the prevalence of NHL subtypes between Asia and the West. For example, follicular lymphoma constitutes 22% of NHL in the US but is reported to represent only S% of NHL in China [4]. The prevalence of follicular lymphoma and prolymphocytic NHL in Japan are also less than in the West while diffuse large B ceil and lymphoblastic NHL are higher [5]. In Korea as well, extranodal diffuse large B cell and angioimmunoblastic T cell NHL are higher than in the West [6]. In contrast to the US, NHL of T cell origin is almost twice as prevalent in China, Japan and Korea [7]. Conflicting results have been reported for the prevalence of CLLlSLL in Asian and Western populations [8]. CLL is the most common chronic lymphoproliferative disorder in the West accounting for approximately 2S-38% of all leukemias. Alternatively, previous studies have reported the incidence of CLL in Asian populations (e.g., Chinese, Japanese and Singapore Chinese) to be 12-20 times lower, occurring in only l.2-2% of Eastern patients. However, Kwong and colleagues [9] found that CLL represents 12.S% of all leukemias diagnosed in Hong Kong over a 3-year period. The etiology of NHL is complex. Genetics, immunologic or other neoplastic diseases, as well as infectious agents, including viruses such as Epstein-Barr virus (EBV), Hepatitis Band C virus, and Human Immunodeficiency virus (HIV) , appear to influence differences in the prevalence of NHL worldwide [10-13].
The object of this study was to diagnose and classify all
lymphoid neoplasms that presented over a 4-year period in
a single diagnostic laboratory in Shanghai, China. A total of 831 consecutive cases of lymphoid neoplasms met criteria for diagnosis and classification according to WHO. Herein, we present and compare distribution of NHL subtypes obtained in our prospective series with a recent report of retrospective classification of lymphoid tumors in China using WHO criteria [14]. We also include patient demographics, laboratory values, viral serology and cytogenetic
data for the major NHL subtypes diagnosed in our laboratory.
2 Materials and methods
2.1 Case series
Patients :::: 18 years presenting at Shanghai hospitals between August 2003 and May 2007 were referred to our laboratory based on initial clinical presentation. Protocol approval for this case review was obtained by the Combined Multiple Institutional Review Board of the University of Colorado at Denver and Health Sciences Center in Denver, CO and the Internal Review Board at Fudan University in Shanghai, China.
2.2 Sample collection and clinical laboratory analysis
Peripheral blood, bone marrow aspirates, tissue and core biopsies were collected in conjunction with diagnostic procedures and were evaluated in our laboratory. Peripheral blood smears weie obtained by finger stick. Blood samples were collected by venipuncture and processed for routine CBC (CellDyne 3700, Abbott, Park, IL), viral serology (HCV and HIV) (Imx, Abbott) and clinical chemistry for liver enzymes (LDH, ALT and AST enzymes) (COBAS, Integra 400 plus, Roche Diagnostics, Shanghai, China).
2.3 Morphology
Bone marrow aspirates and core biopsies were obtained by Jamshidi needle extraction from the posterior iliac crest, while lymph node and tissue biopsies were obtained by surgical resection. Bone marrow smears were prepared and evaluated using Wright-Giemsa stained preparations and special stains. A broad panel of antibodies were used for immunophenotyping of bone marrow and lymphoid cells by either dual laser flow cytometry (FC-SOO, Beckman Coulter, Hialeah, FL; Immunotech, Miami, FL), immunoperoxidase-immunohistochemistry of tissue sections or both. Biopsy sections were stained with HematoxylinEosin (H&E). Morphology was independently evaluated by three of us (X.-Z. Z., R D. I., 1. R). Microscopic analysis was performed using Olympus BXSI bright field microscopes (Olympus Optical Ltd., Tokyo, Japan).
2.4 Cytogenetic analysis
Conventional cytogenetic analysis was performed on unstimulated (1-2 day), and B cell mitogen stimulated (3day) (lipopolysaccharide) (Sigma, St. Louis, MO), cultures
~ Springer
Prospective study of NHL in Shanghai, China
167
of bone marrow or lymph node preparations. A minimum of 20 metaphases were analyzed in each case. Criteria for a clone and descriptions of karyotype followed the recommendations of the International System for Human Cytogenetic Nomenclature (1995) [15].
2.5 Fluorescence in situ hybridization analysis (FISH)
FISH analysis was performed on bone marrow or lymph node preparations using Vysis probes (Downers Grove, lllinois) to identify JGH114q34, ALKi2p23 CCNDJ/JGH/ t(11;14), BCL2/IGHlt(l4;18) and other abnormalities as required. Sample preparations and hybridizations were conducted following the manufacturer's recommendations. Whenever possible, a minimum of 500 interphase cells were scored for each probe. A clonal aberration was defined as the percentage of cells with any given aberration over the normal eut-off limits that were determined from ten cytogenetieally normal individuals.
3 Results
3.1 Total number lymphoid neoplasms diagnosed using WHO classifieation eriteria
A total of 831 eonseeutive lymphoid neoplasms were
diagnosed aeeording to the WHO elassification over a
4-year period (Table 1). The
of B ccll neoplasms as
compared to TINK cell neoplasms was 68.4 and 18.2%,
respeetively. A total of 103 eases of Hodgkin lymphoma
were diagnosed, which eonstituted 12.4% of total lymphoid
neoplasms. Using WHO eriteria, a total of 728 NHL were
diagnosed, ineluding precursor Band T cell leukemias as
well as lymphomas (Table 2). B eell NHL composed
=78.0% (n 568) of all NHL cases whereas TINK cell
Table 1 Total number of lymphoid
diagnosed in series by
WHO criteria in Shanghai, China over a 4-year period
Total lymphoid neoplasms
n 831 Percent of total (%)
Mature B cell neoplasms
428
Precursor B lymphoblastic lymphoma 3
Precursor B lymphoblastic leukemia 137
Total B cell NHL
568
Mature T/NK cell neoplasms
105
Precursor T lymphoblastic lymphoma 21
Precursor T lymphoblastic leukemia 25
Total TINK cell NHL
151
NHL NOS
9
Hodgkin lymphoma
103
51.5 <1
16.5 68.4 12.6
2.5 3.0 18.2 1.1 12.4
NHL composed 20.7% (n = 151) of the total NHL cases diagnosed in our series.
3.2 NHL subtypes defined by WHO criteria
B cell NHL was at least 3 times more prevalent than T cell
NHL (568 and 151, respectively) (Table 2). The most
frequent subtype of B eell NHL diagnosed in our labora-
tory was diffuse large B cell lymphoma (n = 212)
followed by precursor B lymphoblastic leukemia/lym-
= =phoma (n 140) and then CLLlSLL (n 71),
representing 29.1, 19.2 and 9.8% of all NHL diagnosed in
our laboratory, respectively. The most commonly diag-
nosed type of TINK cell NHL was precursor T
lymphoblastic leukemiallymphoma (n = 46) followed by
=peripheral T eell lymphoma, unspecified (n 40) and
angioimmunoblastic T cell lymphoma (n 26). These
findings differ somewhat from those of Wang et al. (2005)
[14] who reclassified 447 archival specimens of malignant
lymphoma presenting at the Shanxi Tumor Hospital in
Taiyuan, China, over an 8-year period using the WHO
classification. They found diffuse
B cell lymphoma to
be the most common NHL subtype (35.1 %) followed by
peripheral T eell lymphoma, unspecified (12.0%), extran-
odal marginal zone B cell lymphoma (11.7%) and
foHicular lymphoma (8.6%). Cases of TINK cell neoplasms
comprised 30.6% ofNHL reported for this re-classification.
3.3 Gender and age distribution of NHL subtypes as defined by WHO criteria
The gender and age distribution for NHL cases presenting in our laboratory is displayed in 1. The overall gender distribution for NHL in OUr laboratory was approximately 2:1 male to female (443 and 285, respectively). Gender distribution of B cell NHL favored male (60%) over female (40%) and was similar for TINK eell NHL, male (64%) female (36%). There was a marked male predisposition for CLLlSLL (3: 1) and mantle cell lymphoma (3.7:1). Females with precursor B lymphoblastie leukemia slightly outnumbered males (1.06: 1). However, when normalized for gender, the prevalence of preeursor B lymphoblastic leukemia in females was twice that observed in males. Males with peripheral T cell lymphoma, unspecified (PTCL-u) outnumbered females (1.8: 1). However, when normalized for gender the prevalence of PTCL-u was equal in males and females. The median age for all NHL and Bcell NHL was 56 and 58 years, respeetively. The median, age for TINK cell neoplasms was slightly younger (49 years). Overall there were no obvious differences between males and females for age at presentation with the exception of precursor B lymphoblastic leukemia for which the median
~ Springer
168
Table 2 Comparison of the distribution of NHL subtypes in China classified according to WHO criteria
" Diagnosed and classified in series at a single diagnostic laboratory in Shanghai China over a 4-year period (n = 728) b Adaptation from Iinfen Wang et al. (2005) [14] (n = 385)
B-cell NHL TINK cell NHL NHL NOS Diffuse large B cell lymphoma Precursor B lymphoblastic leukemia"(l37)/
lymphoma"(3) Chronic lymphocytic leukemia'(29)!
small lymphocytic lymphoma"(42) Follicular lymphoma Precursor T lymphoblastic leukemia"(25)/
lymphoma"(2l) Peripheral T cell lymphoma, unspecified Angioimmunoblastic T cell lymphoma Plasma cell myeloma Extranodal marginal zone B cell lymphoma (MALT)' ftn'"p'"lM1C large cell lymphoma Mantle cell lymphoma Burkitt lymphoma"(l0)lleukemia"C2) Aggressive NK cell leukemia Nodal marginal zone B cell lymphoma Lymphoplasmacytic lymphoma Splenic marginal zone lymphoma Extranodal NKrr cell lymphoma T cell prolymphocytic leukemia B-cell prolymphocytic leukemia T cell large granular lymphocytic leukemia Other NHL subtypes represented at <1 %
S. A. Gross et al.
Distribution in Shanghai" (n = 728) % (n)
78.0 (568) 20.7 (151) 1.2 (9) 29.1 (212) 19.2 (140)
9.8 (71)
7.0 (51) 6.3 (46)
5.5 (40) 3.6 (26) 2.9 (21) 2.5 (18) 2.1 (15) 1.9 (14) 1.6 (12) 1.2 (9) 1.1 (8) 0.8 (6) 0.7 (5) 0.6 (4) 0.6 (4) 0.6 (4) 0.6 (4) <2.5 (18)
Wang et al. b
=(n 385)
% (n)
68.3 (263) 30.6 (119)
35.1 (135) LO (4)
3.6 (14)
8.6 (33) 7.0 (27)
12.0 (46) 2.3 (9) 1.3 (5) 11.7 (45) 4.2 (16) 2.6 (10) 0.3 (1) (0) 0.5 (2) 2.3 (9) 0.3 (1) 1.3 (5) 0.5 (2) 0.5 (2) (0) <1.0 (4)
age at presentation for males and females was 38 and 47 years, respectively.
3.4 Distribution of NHL cases from Shanghai and nearby provinces
The vast majority of NHL cases presenting were from
Shanghai (78.5%) (Table 3),
cases that constitute
the most prevalent NHL subtypcs diagnosed in our labo-
ratory. We recorded 18 cases of CLLlSLL and DLBCL in
patients from neighboring
(4 and 14, respec-
tively). Moreover, 47 of our NHL cases came from Jiangsu
province (including 5 CLLlSLL and 12 DLBCL). Other
than Shanghai, there were no distinct clusters of NHL
subtypes associated with a spccific province.
3.5 Clinical features associated with NHL subtypes
Clinical findings for the most prevalent B cell and TINK cell NHL subtypes are illustrated in Table 4. Abnormal mean
hematologic values indicated peripheral blood involvement for 8 out of the l3 major NHL subtypes presented. Predictably, NHL cases presenting as leukemia, precursor B lymphoblastic leukemia and precursor T lymphoblastic leukemia, showed hematologic abnormalities in multiple lineages. The LDH index was elevated in 11 NHL subtypes with the highest levels observed for precursor B lymphoblastic leukemia. Histological grading of follicular lymphoma cases was performed based on the absolute number of centroblasts present in neoplastic follicules. These findings indicate that 430/0 of the follicular lymphoma cases in our laboratory were classified grade 3. Viral serology for hepatitis C virus (HCV) was performed in 509 NHL cases (data not shown). Only five cases were positive for HCV serology: three cases of precursor B lymphoblastic leukemia, one case of angioimmunoblastic T cell leukemia and one case of anaplastic large cell lymphoma. Serology for HIV was measured in cases ofNHL, but because individuals testing positive for HIV in China are routinely quarantined,
no HIV+ cases of NHL were encountered in this series.
~ Springer
Prospective study of NHL in Shanghai, China
169
A 30%
25%
-20%
c:
<II
f:
15%
CIl
!l. 10%
5%
0%
All NHL
19-29 30-39 40-49 50-59 60-69 70-79 Age (years)
>80
B 30%
25%
C 20%
QJ
f: 15% cC..Il 10%
5% 0%
8-cell NHL
19-29 30-39 40-49 50-59 60-69 70-79 Age (years)
>80
C 25%
20%
C
CIl
15%
f:
ci.l.l 10%
5%
TINK-cell NHL
0% 19-29 30-39 40-49 50-59 60-69 70-79 >80
Age (years)
Fig. 1 Age and gender distribution for both males and females diagnosed with a All NHL, b B cell NHL and c T cell NHL in Shanghai, China
3.6 Clonal abnormalities associated with NHL subtypes
Cytogenetic and/or FISH analysis was performed in 724 out of 728 cases of NHL. Informative analysis was obtained in 603 cases and the overall rate for clonal abnormalities in all NHL cases was 81 %. Cytogenetic abnormalities for the most prevalent B cell and TINK cell NHL subtypes are presented in Table 5. The most common cytogenetic abnormality observed in precursor B lymphoblastic leukemia was t(9;22) (37%). Predictably, all follicular lymphomas had clonal cytogenetic abnormalities with complex abnormalities observed in 72% of cases. However, t(14; 18) was observed in only 37% of follicular lymphoma cases. Trisomy 12 (+ 12) was observed in 25% (13/52) of CLLlSLL cases where clonal abnormalities were
Table 3 Distribution of NHL cases from Shanghai and nearby provinces
Province
Percent
Shanghai Zhejiang Jiangsu Anhuei Jiangxi Sichuan Other'
a Additional provinces each represented at less than 0.5
78.5 7.5 6.4 3.3 1.6 0.7 <2.0
observed. Overall, complex karyotypes predominated in all NHL subtypes. Whenever possible, genetic aberrations observed in chromosomal analysis were further confirmed by FISH analysis with appropriate probes (Fig. 2).
4 Discussion
We present 831 consecutive cases of newly diagnosed lymphoid neoplasms evaluated in a single laboratory in Shanghai, China. Patients with suspected lymphoid neoplasms were referred from 29 participating hospitals in the Shanghai area. Prospective diagnosis and disease classification were based on the WHO system (2001) [2]. Consistent with previous reports, our findings indicate that 87.6% of the lymphoid neoplasms are NHL and 12.4% are Hodgkin lymphoma [14]. Of the NHL cases diagnosed in our series, the frequency of B cell NHL is 78.0% and TINK cell NHL is 20.7%, confirming that although B cell neoplasms predominate, NHL of TINK ceIl origin are more frequently encountered in China than in the West [14, 16, 17]. Predictably, there is a general 2: 1 predisposition of males over females for all NHL. Notable exceptions were CLLlSLL (male:female = 3:1), mantle cell lymphoma (male:femaie = 3.7: 1) and precursor B lymphoblastic leukemia (male:female = 0.94: 1).
Historically, the largest previous Western study of NHL employed the REAL system which classified solid tumors of immature Band T cell origin as lymphoblastic lymphoma. Precursor Band T cell leukemias were evaluated separately as acute lymphoblastic leukemia (ALL). Armitage and colleagues [18] compiled 1,403 cases of NHL diagnosed by REAL from 9 different countries and reported diffuse large B cell lymphoma (31 %) was the most common form of B cell neoplasm followed by follicular lymphoma (22%). CLLlSLL, peripheral T cell Iymphomaunspecified, mantle cell lymphoma and extranodal marginal zone B cell lymphoma were all represented relatively equally in the population (5-6%). Lymphoid neoplasms of T cell origin represented only 9-10% of NHL. Similar to
~ Springer
170 S. A. Gross et al.
Table 4 Mean laboratory values for the most prevalent NHL subtypes diagnosed in series according to WHO in Shanghai, China in a 4-year period
ANC (l091L) ALC (l09JL) PLT (l09JL) Hgb (g/dL) LDH Index
Diffuse large B celllymphoma"(125/2l2) Precursor B lymphoblastic leukemia"(1371137) Chronic lymphocytic leukemia/small lymphocytic lymphoma"(5417l) Follicular lymphoma"(26/5l) Extranodal marginal zone B cell lymphoma (MALT)"(l3118) Plasma cell myelomaa(2ll2l) Mantle cell lymphoma"(7114) Peripheral T cell lymphoma, unspecified"(23/40) Angioimmunoblastic T celllymphoma"(l6126) Precursor T lymphoblastic leukemiaa(25/25) Anaplastic large cell lymphoma a (8/15) Precursor T lymphoblastic lymphoma "(5121) Burkitt lymphoma "(6110)
3.7 2.2 2.9 3.7 1.9 2.8 3.3 3.1 4.4 2.2 5.4 3.6 3.8
1.4 l8.6b 12.7b 1.7 6.2 2.7 3.9 1.9 1.3 27.2b
6.0 2.3 5.9
200.2 71.0b
171.1 207.5 1.35.0 132.6 142.5 176.5 200.0 124.0 199.0 247.4 240.0
12.1 9.0 b 11.9 b
13.3 7.7 b 6.7 b l1.7b l1.2b
12.0 10.2b l1.9b
12.3
12.0
4.7 b
4.2b
1.1 1.3b
0.9
1.2b 1.3 b 1.3b l.4b 3.6b 2.l b 1.2b 2.8 b
Abbreviations and references ranges: absolute neutrophil count (ANC) 2-7 x 109 L-\ absolute lymphocyte count (ALC) 1.6-6 x 109 L-1,
platelet count (PLT) 100-300 x 109 L-I, lactate dehydrogenase (LDH) Index = n IU L-1 (255 ill L-1)-1, hemoglobin (Hgb) 12-16 g dL -1
Cases with laboratory values versus total number of cases 0
b Indicates abnormal laboratory value
Annitage, diffuse large B cell lymphoma (4S%) was the most prevalent NHL SUbtype diagnosed in our laboratory in Shanghai. However, significant differences were observed between our series and Armitage for CLLlSLL, follicular lymphoma and T cell neoplasms. CLLlSLL was almost 3 times more prevalent in our series (1S%), whereas follicular lymphoma represented only 11 % in our series compared to 22% in Annitage. Malignant lymphoma of T cell origin was also more prevalent in our series (24%) compared to Armitage (9-10%).
A total of 81 % of CLLlSLL presented with structural cytogenetic abnormalities in our series. The most frequently encountered abnormality was trisomy 12 (2S%) which is similar to that reported in Western popUlations ( ~ 20%) [2]. Conflicting reports concerning the prevalence of CLLlSLL in Asia have appeared over the last decade with the prevalence ranging from 3.6% (Wang et al. 200S) to 12.S% (Kwong et al. 1994) [9, 14, 16]. Our findings indicate a relatively high prevalence of CLLlSLL for NHL in Shanghai (9.8 and IS% for WHO and REAL, respectively). A possible explanation for the disparity between these results and some other studies may involve variations in the sampling and/or diagnostic methodologies employed. Historically in China, lymphoid neoplasms presenting as leukemias are more likely to be reported by hematologists, whereas solid lymphoid tumors are more likely to be encountered by pathologists. Therefore, even utilizing WHO 2001 criteria, retrospective studies may have a selection bias based on the source of material sampled for evaluation.
The potential impact of sampling bias is further illustrated by the marked difference in prevalence between precursor B lymphoblastic leukemia in our series (19.2%) compared to Wang et al. (1.0%) [14]. Even though both employed WHO diagnostic criteria, the vast majority of precursor B lymphoblastic leukemia in our series initially presented as hematology cases and not as solid tissue tumors. The majority of studies of precursor B lymphoblastic leukemia focus on children with immature B cell leukemia being the most common fonn of leukemia diagnosed in the West under the age of 6 years and in youths [19]. However, in the West adult precursor B lymphoblastic leukemia is rarely diagnosed in the general adult population (0.7-1.8/100,000 per year) [20]. Precursor B lymphoblastic leukemia/lymphoma was the second most frequently diagnosed lymphoid neoplasm in our series.in Shanghai (n = 140). Taken together, these findings suggest that the adult form of the disease may be under-reported in China. Not only did females predominate in precursor B lymphoblastic leukemia, there was a marked gender difference in the median age at presentation; suggesting possible differences in the etiology or pathogenesis of precursor B lymphoblastic leukemia.
Reflecting the lower prevalence of follicular lymphoma in Asian populations relative to the West, this disease represented only 7% of the NHL in our series based on WHO classification [4, 14, 17,21-23]. Although, complex cytogenetic abnormalities were observed in virtually all cases analyzed in this series, an explanation for the low frequency of t(14;18) is not immediately apparent.
~ Springer
Prospective study of NHL in Shanghai, China
171
Table 5 Clonal abnormalities in NHL subtypes diagnosed in series according to WHO in Shanghai, China in a 4-year period
Definitions: Abn. Refers to an abnormality in a particular chromosome. Complex refers to a karyotype with greater than two independent cytogenetic lesions. InfOlmative cytogenetic and/or FISH analysis refers to cases with a positive FISH analysis and either a normal karyotype or abnormal karyotype in greater than or equal to 20 metaphases (see Sect. "Materials and methods") a All cases of Burkitt Lymphoma were positive for cmyc by cytogenetics, FISH or immunohistochemistry
NHL subtype
Patients with informative analysis (%)
Structural abnormalities (%)
Most common' abnormality
Diffuse large B cell lymphoma
Precursor B lymphoblastic leukemia
Chronic lymphocytic leukemia/small lymphocytic lymphoma
Follicular lymphoma
Extranodal marginal zone B cell lymphoma Plasma cell myeloma Mantle cell lymphoma Peripheral T cell lymphoma, unspecified
Angioimmunoblastic T cell lymphoma Precursor T lymphoblastic leukemia Anaplastic large cell lymphoma Precursor T lymphoblastic lymphoma
Burkitt lymphoma
1801212 (85%)
114/137 (83%)
64171 (90%)
43/51 (84%)
11118 (61%) 16/21 (76%) 12/14 (86%) 28/40 (70%)
19/26 (73%) 21/25 (84%) 11115 (73%) 16/21 (76%)
9110 (90%)
174/180 (97%)
871114 (76%)
52/64 (81 %)
43143 (100%)
4/11 (36%) 11116 (69%) 12112 (100%) 16/28 (57%)
7/19 (37%) 17121(81%) 7/11(64%) 11116 (69%)
4/9 (44%)
Abn, 13 (7%) t(3;14) (10%) 6q- (12%) t(14;18) (3%) IGH rearrangements (26%) t(9;22) (37%) +8 (13%) -7 (10%) +12(25%) IGH rearrangements (21 %) llq- (11%) t(14;18) (37%) + 7 (6%) t(13;14) (8%) IGH rearrangements (14%) Complex (72%) Complex (75%) Complex (82%) tOl;14) (42%) +X 09%) del (6) 09%) Complex (69%) Abn. X or Y (57%) Complex (82%) Complex (86%) Abn. 0)(p36) (27%) abn 5 (27%) Complex (73%) t(8)4) (40%) Complex (43%)
Typical of Asia, the frequency of T cell neoplasms in Shanghai is approximately 3 times higher than encountered in Western popUlations. Surprisingly, rare neoplasms (i.e., anaplastic large T/null cell lymphoma, angioimmunoblastic T cell lymphoma and aggressive NK cell leukemia) together constituted the majority of T cell lymphomas, while peripheral T cell lymphoma was not encountered more often than reported in Western studies [17, 18]. The majority of these tumors exhibited complex karyotypes. EBER positive cells were detected in 63% of angioimmunoblastic T cell lymphoma and in all cases of aggressive NK cell leukemia (a diagnostic criteria for this disease) [24].
NHLs are a heterogeneous group of neoplasms with complex clinical, biological and molecular features. It is becoming increasingly appreciated that significant regional differences in the pattern of NHL subtypes exist that can be attributed to multiple factors, such as infection, family history, genetic predisposition, autoimmune disease, environment, immunosuppression as well as methodologic limitations or artifact. Our findings provide the first prospective basis for comparison of the prevalence of NHL SUbtypes in Shanghai based on WHO 2001 criteria and serve as a point of departure for future studies to better understand the contribution of multiple influences on the development of these diseases in China.
~ Springer
172 S. A. Gross et al.
Acknowledgments We would like to extend Qur appreciation to Ann Louden for manuscript and clerical assistance and Allan Holsomback for database management. We would also like to thank the participating hospitals including Cancer Hospital, Huashan Hospital, Xinhua Hospital, Long March Hospital, Huang Pu Central District Hospital, Renji Hospital, Ruijin Hospital, Huadong Hospital, Jin An Central Hospital, No.1 People's Hospital, No.5 People's Hospital, No.6 People's Hospital, No.9 People's Hospital, Yang Pu Central Hospital, Zha Bei Central Hospital, Shu Guang Hospital, Chang Ning Central Hospital, Tong Ji Hospital, Shong Jin Central Hospital, Zhong Shan Hospital, Railway Hospital, Rong Hua Hospital, Changhai Hospital, Occupational Disease Hospital, Jiading Central Hospital, 455 Hospital, Shidong Hospital, No. 1 Baoshan Hospital, and Putuo Central Hospital.
References
Fig. 2 FISH analysis of IGH fusion genes. a FISH using IGH BreakApart probe. Fusion signal represents normal; green and red represent rearranged 5' and 3', respectively, of IGH locus. b FISH with the Dual-fusion and Dual-color CCNDlIIGH probe. Fusion signals represent fusion genes. c FISH with the Dual-fusion and Dualcolor BCL21IGH probe. Fusion signals represent fusion genes
1. Aisenberg AC. Understanding non-Hodgkin's lymphoma. Sci Med. 1997;4:28-37.
2. Jaffe E, Harris N, Stein H, Vardiman J. World Health Organization classification of tumours. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon: IARC Press; 200 I.
3. Harris NL, Jaffe ES, Stein H, et al. A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood. 1994;84:1361-92.
4. Hru.~ington DS, Ye Y, \Veisenburger DD, et al. Malignant Lymphoma in Nebraska and Guangzhou, China. Hum Pathol. 1987;18:924-8.
5. Ohshima K, Suzumiya], Sato K, Kanda M, Haraoka S, Kikuchi M. B-cell lymphoma of 708 cases in Japan: incidence rates and clinical prognosis according to the REAL classification. Cancer Lett. 1999;135:73-81.
6. Ko Y-H, Kim C- W, Park C-S, et al. REAL classification of malignant lymphomas in the Republic of Korea: incidence of recently recognized entities and changes in clinicopathologic features. Cancer. 1998;83:806-11.
7. Intragumtornchai T, Wannakrairoj P, Chaimongkol E, et al. NonHodgkin's lymphomas in Thailand: a retrospective pathologic and clinical analysis of 1,391 cases. Cancer. 1996;78:1813-9.
8. Ho FC, Todd D, Loke SL, Ng RP, Khoo RK. Clinico-pathological features of malignant lymphomas in 294 Hong Kong Chinese patients, retrospective study covering an eight-year period. Int J Cancer. 1984;34:143-8.
9. Kwong YL, Wong KF, Chan Le, et al. The spectrum 6f chronic Iymphoproliferative disorders in Chinese people. An analysis of 64 cases. Cancer. 1994;74: 174-81.
10. World Health Organization. World cancer report. Lyon: IARC Press; 2003.
11. Alexander DD, Mink PJ, Adami HO, et al. The non-Hodgkin lymphomas: a review of the epidemiologic literature. Int J Cancer. 2007;120:1-39.
12..Cucuianu A, Patiu M, Duma M, et aI. Hepatitis Band C virus infection in Romanian non-Hodgkin's lymphoma patients. Br J Haematol. 1999;107:353-6.
13. Wang F, Xu RH, Han B, et al. High incidence of Hepatitis B virus infection in B-cell subtype non-Hodgkin lymphoma compared with other cancers. Cancer. 2007;109:1360-4.
14. Wang J, Young L, Win W, Taylor CR. Distribution and Zap-70 expression of WHO lymphoma categories in Shanxi, China: a review of 447 cases using a tissue microarray technique. Appl Immunohistochem Mol Morphol. 2005;13:323-32.
~ Springer
Prospective study of NHL in Shanghai, China
173
IS Mitelman E An international system for human cytogenetic nomenclature: recommendations of the International Standing Committee on Human Cytogenetic Nomenclature, Memphis, TN, October 1994, New York: Karger; 1995,
16, Xiao C, Su ZL, Wu QL, et a1. Clinical and pathological reassessment of 493 cases of non-Hodgkin's lymphomas according to current WHO classification of lymphoid neoplasms, (Chinese), Chinese Journal of Pathology, 2005;34:22-7,
17, Shih LY, Liang DC, Non-Hodgkin's lymphomas in Asia, Hematol Oncol Clin North Am, 1991;5:983-1001.
18. Annitage JO, Weisenburger DD. New approach to classifying non-Hodgkin's lymphomas: clinical features of the major histologic subtypes. Non-Hodgkin's lymphoma classification project. J Clin Oncol. 1998;16:2780-95.
19. Copelan EA, McGuire EA. The biology and treatment of acute lymphoblastic leukemia in adults. Blood. 1995;85:1151-68.
20. Gokbuget N, Hoelzer D. Recent approaches in acute lymphoblastic leukemia in adults. Rev Clin Exp Hematol. 2002;6:114-41.
21. Ohshima K, Suzumiya J, Kikuchi M. The World Health Organization classification of malignant lymphoma: incidence and clinical prognosis in HTLV-I-endemic area of Fukuoka. Pathol Int. 2002;52:1-12.
22. Chuang SS, Lin CN, Li CY. Malignant lymphoma in Southern Taiwan according to the revised European-American classification of lymphoid neoplasms. Cancer. 2000;89:1586-92.
23. Chen CY, Yao M, Tang JL, et a1. Chromosomal abnormalities of 200 Chinese patients with non-Hodgkin's lymphoma in Taiwan: with special reference to T-cell lymphoma. Ann Oncol. 2004;15:1091-6.
24. Ryder J, Wang X, Bao L, Gross S, Hua F, Irons R. Aggressive natural killer cell leukemia: report of a Chinese series and review of the literature. Int J Hematol. 2007;85: 18-25.
'f} Springer
ELSEVIER
Available online at www.sciencedirect.com
SCIENCE@DIRECTO
Leukemia Research 29 (2005) 1371-1380
Leukemza Research
www.elsevier.comllocate/leukres
Chronic exposure to benzene resl+lts in a unique form of dysplasia
Richard D. Ironsa,b,c,d,*, Ling Lva,e, Sherilyn A. Grossa,c, Xibiao Yea,b, Liming Baoa,f, Xiao Qin vVanga,e, John Rydera,d, Thomas W. i\rrnstrong g, Yimei Zhou g, Lizhaung Miao b,
Anh T. c, Patrick J. Kerzicc,vVeimin Nih, Hua Fu a,b
a Sino-US Joint Clinical and Molecular Laboratory (JCML), 138 Yi Xue Yuan Road, Fudan University, Shanghai 200032, China b School ofPublic Health, Fatlan University, 138 Yi Xue liwn Road, Shanghai 200032, China
C Department of PhanlUlce.utica/ Sciences, School ofPharmacy, 4200 East 9th Avenue/Box C238, University of Colorado Health Sciences Cente1; Denver CO 20262, USA
d Departmel1t of Pathology, School ofMedicine, AlP Bldg.lBox F768, University ofColorado Health Sciences Center, Denver CO 80262, USA e Huashan Hospital, Shanghai Medical University, No. 12 Wulumuqi Zhong Road, Shanghai 200040, China
f Division ofHuman Genetics, University of Cinci1Vwti Children's Hospital Medical Center; 3333 Bumett Avenue, Cincinnati OH 45229-3039. USA
g ExxonMobil Biomedical Sciences Inc.. 1545 Route 22 East Room LF294, Annandale NJ 08801-0971, USA h Yangpu District Central Hospital, 450 Tengyue Road, Shanghai 200090, China
Received 19 July 2005; received in re-vised form 12 August 2005; accepted 12 August 2005 Available online 23 September 2005
Abstract
Hematotoxicity following chronic benzene exposure has been recognized for over a century, although the mechanism remains unknown. We describe a novel form of bone marrow dysplasia in 23 workers exposed to high concentrations of benzene. Distinguishing features of benzene-induced dysplasia include: marked dyserythropoiesis, eosinophilic dysplasia and abnormal cytoplasmic granulation of neutrophilic precursors. Hematophagocytosis, stromal degeneration and bone marrow hypoplasia are also seen. Severe bone marrow dysplasia is frequently accompanied by clonal T cell expansion and alterations in T lymphocyte subsets. No clonal cytogenetic abnormalities were observed. These results suggest that autoimmune-mediated bone marrow injury is an early or predisposing event in the pathogenesis of benzene-induced persistent hematopoietic disease. 2005 Elsevier Ltd. All rights reserved.
Keywords: Myelodysplastic syndrome; Hematotoxicity; Benzene; Immunopathology
1. Introduction
Myelodysplastic syndrome (MDS) is a heterogeneous group ofdiseases characterized by ineffective hematopoiesis, dysplasia in one or more hematopoietic lineages, clonal evolution and a tendency to progress on to bone marrow (BM) failure or acute myelogenous leukemia (AML). The etiology and pathogenesis of MDS are unknown, with genetic, infectious and environmental influences variously suggested to playa role in conferring susceptibility to these diseases.
Corresponding author. Tel.: +13033157170; fax: +13033157237. E-mail address: richard.irons@uchsc.edu (R.D. Irons).
0145-21261$ see front matter 2005 Elsevier Ltd. All rights reserved. doi: I 0.1 016/j .leukres:2005.08.019
Clonal cytogenetic abnormalities, abnormal cytokine production and immune activation all are prominent features of MDS, and it has been hypothesized that damage to hematopoietic stem or progenitor cells leads to immunologic response directed against antigens in the hematopoietic environment [1-4]. Nevertheless, neither the initial clonal origin of MDS nor the cellular or molecular targets of activated inunune cells, or even the order of events in the evolution of the disease have been identified, and a unifYing hypothesis for the pathogenesis ofMDS in general or for individual subtypes remains elusive.
Chronic exposure to benzene is known to result in bone marroW failure and increase the risk ofAML [5-7]. Previous
1372 R.D. Irons et al. / Leukemia Research 29 (2005) 1371-1380
descriptions of AML associated with occupational exposure to pesticides or solvents that have contained benzene suggest a pattern of disease similar to therapy-related AML (tAML), although direct evidence lin.k.. ing benzene to tAML is lacking [8-1l], and the mechanism of benzene-induced hematotoxicity remains unknown. Chronic exposure to high concentrations of benzene has long been associated with aplastic anemia (AA), diagnosed nearly always on the basis of pancytopenia, with hundreds of cases reported during the first half of the 20th century. However, direct evaluation of BM was almost never performed in these cases [12-14]. Although, AA and MDS are thought to be related conditions, MDS is 'distinguished from other forms of progressive BM failure by the presence of dysplasia and a tendency to progress or evolve into AML. MDS (non-specific) has previously been reported in a very small number of benzene workers who were generally described as having hypocellular bone marrow and dyserythropoietic changes [15]. In contrast, the majority of cases of de novo MDS present with hypercellular BM and abnormal hematopoietic cell morphology, while a hypocellular BM is observed only in a subset of de novo cases. In 2001, the World Health Organization (WHO) published new criteria for the diagnosis of MDS subtypes [16]. Dysplasia in one or more lineages is a central diagnostic feature ofMDS, although cytopenia, anemia, or pancytopenia, together with BM hypercellularity and a blast cell count <20% are prominent characteristics of most subtypes of the disease.
We describe a novel pattern of dysplasia developing in 23 individuals who were previously exposed to high concentrations ofbenzene. The evaluation of these patients employing current diagnostic and molecular techniques has given us the opportunity to revisit and to further characterize the clinical paradigms associated with benzene-induced hematotoxicity and to examine early events in the pathogenesis of persistent benzene-induced blood disease. Most cases of benzeneinduced dysplasia exhibited BM pathology that was characterized by: hypocellularity, multilineage dysplasia including megaloblastic changes, marked dyserythropoiesisand abnormal granulation in the cytoplasm of maturing neutrophilic precursors and neutrophils. A particular striking feature was a severe dysplasia in eosinophilic precursor cells. Additional findings were consistent with altered inflammatory and immune response, including prominent hematophagocytosis, increases in circulating large granular lymphocytes (LGLs) and altered distribution ofCD4 and CD8 T cells which were often accompanied byevidence of clonal expansion ofT cell subpopulations in BM. Significantly, thepe~ipheral blood CBC was nearly normal in approximately 25% of cases. These findings suggest a distinct form ofmultilineage dysplasia in individuals chronically exposed to benzene, and provide evidence for a prominent role for altered immune response in the development of benzene-induced dysplasia. These findings further suggest that routine CBC may not be a reliable monitor for BM injury following chronic exposure to benzene.
2. Materials and methods
2.1. Patients
Patients were referred by physicians to Shanghai hospitals based on initial clinical presentation and/or a medical history of benzene intoxication. Participation was voluntary and the framework for consent was obtained according to the Declaration ofHelsinki, 2004 and the NIH Common Rule (45 CFR 46). Informed consents were approved by both the Colorado Multiple Institutional Review Board and the Internal Review Board at Fudan University in Shanghai, China. All individuals were administered questionnaires requesting information on medical, occupational and environmental history. A total of 27 subjects employed in the rubber, petrochemical, pharmaceutical, manufacturing or painting industries were referred to our laboratory with a history ofbenzene poisoning. Previous occupational exposure to benzene was independently confirmed by: review of factory industrial hygiene monitoring records, real time quantitative industrial hygiene analysis, including personal samples (n = 325) and breathing zone analyses (n = 225), and/or previous evidence of hydrocarbon intoxication and anecdotal descriptions of solvent use and composition. Benzene from personal samples (3M 3500 organic vapor monitors) and area samples were measured according to the National Institute for Occupational Safety and Health (NIOSH) method with minor changes [17] and were performed using a Finnegan Trace Gas Chromatograph Ultra with a Flame Ionization Detector (FID) , autosampIer and SPB-l capillary collimn (30 m x 0.25 mm x 0.25 m) (Agilent Technologies, Wilmington, DE). Individuals for which quantitative data was available (n = 17) were estimated to have full shift exposures averaging between 50 and 300 parts per million (ppm) benzene for varying periods of time ranging from 6 to 22 years and were removed from exposure an average of 2.7 years prior to evaluation in our laboratory (Table 1). Patients were evaluated for potential confounding factors, including: vitaminB 12, folate or iron deficiencies and viral status (i.e. HCV, HIV). Two patients were excluded due to concurrent iron deficiency, and two patients were excluded because ofinability to confirm exposure to benzene. The final study series consisted of 16 females and 7 males with a mean age of 44.4 year (S.D. = 7.8). This represents a small subset of individuals chronically exposed to high concentrations of benzene at the facilities studied.
2.2. Hematology andfiow cytometry
Peripheral blood (PB), BM aspirates and core biopsies were collected in conjunction with diagnostic procedures and were evaluated in our laboratory. Peripheral blood smears were obtained by finger stick. Enumeration of LGL was performed by visual examination of Wright-Giemsastained smears. Blood samples were collected by venipuncture and processed forroutine CBC (CellDyne 3700, Abbott, Park, IL), viral screen (HCV and HIV) (IMx, Abbott
R.D. IrollS et al.I Leukemia Research 29 (2005) 1371-1380
1373
Table I Initial presentation
benzene poisoning'
Case
Exposure duration (ye<U')b
Time since last exposure (month)C
Signs/symptomsd
Laboratory findingsd
17
26
3 19 4 13
5 ND
6 20 78 8 22 97
]0 17
II ND 12 8 13 7
14 16 15 6 16 15 17 10
18 9
19 15
20 13 21 14
22 18
23 16
48
24 24 48 96
0 3 36 36 24 24 48 48 27
56 36
30
36
24 13
3
9 48
Bleeding, fatigue Bleeding, fatigue, dizziness Bleeding, fatigue ND ND Bleeding, fatigue, dizziness Bleeding Fatigue, dizziness Bleeding, fatigue Bleeding, fatigue ND Bleeding, dizziness Bleeding, fatigue ND Bleeding, infection, fatigue Fatigue, dizziness Bleeding, fatigue, dizziness Bleeding, fatigue, dizziness ND Ble~ing, dizziness ND Infection ND
Pancytopenia Thrombocytopenia/leukopenia Pancytopenia Granulocytopenia Leukopenia ND Thrombocytopenia Pancytopenia GranUlocytopenia/anemia Leukcopenia ND Anemia Pancytopenia Thrombocytopenia Pancytopenia Pancytopenia Leukopenia/thrombocytopenia Pancytopenia ND Leukopenia/thrombocytopenia Leukopenia/thrombocytopenia Leukocytosis Leukopenia/thrombocytopenia
All subjects were originally diagnosed with benzene poisoning according to Chinese occupational health criteria (i.e. a total WBC count <4000 (x 106/1) or 4000-4500 (x \06/1) and a platelet count <80,000 (x 106/1, employment in a factory with documented benzene exposure for at least 6 months and exclusion ofother causes for abnormal blood counts).
b Duration of chronic exposure to benzene prior to initial complaint.
C Time between cessation of benzene exposure and diagnosis of benzene-induced dysplasia in our laboratory. d Signs, symptoms and laboratory findings consistent with hematologic injury documented at the time of exposure. ND indicates information that was not available.
Laboratories, Abbott Park, IL), clinical chemistry for liver enzymes (LDH, ALT and AST enzymes) (COBAS, Integra 400 plus, Roche Diagnostics, Shanghai, China) and serum analysis for nutritional factors. Vitamin B 12 and folate were measured by chemical luminescence (Beckman Coulter Dxi800), and total iron binding capacity was measured using a Beckman Coulter LX20. BM aspirates and core biopsies were obtained by Jamshidi needle extraction from posterior iliac crest. Aspirates were stained with fluorochromeconjugated antibodies for flow cytometric analysis of BM cellular subsets. Antibody panels included: anti-CD45, CD4, CD8, CD3 (Beckman Coulter, Hialeah, FL; Immunotech, Miami FL). Multiparameter analysis was perfonned on stained BM cells using a dual laser flow cytometer (FC500, Beckman Coulter) equipped with compensation software (Software CXP, Beckman Coulter).
2.3. Bone marrow morphology
BM smears were prepared and evaluated using WrightGiemsa stained preparations and special stains. Core biopsy sections were evaluated using sections stained with Hematoxylin-EOSIn, Gomori trichrome, and immunoperoxidaseimmunohistochemistry. Morphology was independently evaluated by two of us (R.D.I., lR.). Dyserythropoiesis was scored on the basis of abnonnal nuclear morphology,
including internuclear bridging, abnonnal budding, multi-
ple nuclei and abnormal mitotic figures or megaloblastoid
features. Myeloid or granulocytic dysplasia was defined by
nuclear hypolobulation, (i.e. pseudo-Pelger Huet cells, hyper-
segmentation, abnonnal mitotic fonns) either hypo- or hyper-
granulation of the cytoplasm as well as the presence of large
irregular granules. Megakaryocyte dysplasia was defined by
non-, or hyper-lobulated nuclei, multiple individual nuclei
or the presence of prematurely segmented or "shedding"
cytoplasm. Eosinophilic dysplasia was defined by the pres-
ence of megaloblastoid features and abnormal cytoplasmic
basophilic and eosinophilic hypergranulation. Microscopic
analysis was performed
an Olympus BX51 bright field
microscope (Olympus Optical, Ltd., Tokyo, Japan) equipped
with a Sony EXwave HAD color video camera (Sony Ltd.,
Tokyo, Japan). Images were processed using software cus-
tom designed for the purpose (Vision Image Technology,
Shanghai, China), and photomicrographs were cropped and
edited using Adobe Photoshop (San Jose, CA). Cases of
benzene-induced dysplasia were compared to MDS subtypes
diagnosed according to the WHO classification system
2.4. Cytogenetic analysis
Fluorescence in situ hybridization (FISH) and cytogenetic analyses were performed on unstimulated BM cells
1374
R.D. Irons et al. / Leukemia Research 29 (2005) 1371-1380
following 24-72 h of culture. Chromosomes were prepared and G-banding after trypsin was performed according to standard techniques. If possible, 29 metaphases were analyzed. Interphase or metaphase FISH analyses were performed on the short-term cultured cells or metaphases prepared from the BM or PB samples. All probes used in the FISH studies were purchased from Vysis (Downers Grove, Sample preparations and hybridizations were performed according to the protocols provided by the manufacturer. Slides were viewed using an Olympus fluorescence microscope (Olympus Optical, Ltd., Tokyo, Japan) equipped with the appropriate filters and the PowerGene Macprobe image analysis system (Applied Imaging International Ltd., Newcastle, UK). Whenever possible, 1000--2000 nuclei were analyzed for each probe and scored by two readers. Signal patterns for each probe were compared against a reference range established from analysis of I00 samples from individuals with no evidence of clonal disease or previous benzene exposure.
2.5. Analysis ofFLT3 mutations
FLT3 mutations are often encountered genetic abnormali-
ties in AML, frequently involving an internal tandem duplica-
tion (lTD) or activation loop mutations in the tyrosine kinase
domain (TKD) of the FLT3 gene [18,19]. FLT3 mutations
were determined by PCR analysis and sequencing using DNA
isolated from BM cells. Genomic DNA was isolated from
blood and BM samples using A Qiagen QIAmp DNA mini
Kit (Chatsworth, CA) according to the manufacturer's direc-
tions. Exons 14 and 15 and the intervening sequence intron of
the FLT3 gene were amplified by PCR to detectITD. ThePCR
products were run on both 2% agarose gel and 5% polyacry-
lamide geL Exon 20 of the FLT3 gene was also amplified by
PCR to detect TKD using primers as reported by Yamamoto
et aL [20]. These PCR products were subjected to digestion
by EcoRV and analyzed on a 3.5% agarose gel. Finally, PCR
products were isolated from the gels
the DNA Recov-
ery Kit (Biologic Technology Co., Shanghai, China) and
directly sequenced on an ABI 377 DNA Sequencer (Applied
Biosystems, Foster City, CA).
2.6. T cell receptor (TCR) rearrangement analysis
Detection of clonal and oligoclonal expansion of T cell populations was determined by analysis of rearrangements ofTCR beta (TCR[3), TCR gamma (TCRl') and TCR delta (TCRn) genes by multiplex PCR using BIOMED-2 kits (InVivoScribe Technologies, San Diego, CA) according to the manufacturer's protocol. For the TCR(3 gene, the kit comprised of three individual master mix reactions, the TCRy kit utilized two master mixes and TCR8 kit utilized a single PCR master mix. Amplification of TCR(3, y and 8 genes was performed in a thermocycler and the PCR samples were loaded unto a 6% non-denaturing polyacrylamide TBE gel, stained with ethidium bromide, visualized by UV illumination and documented by digital photography. Clonahearrangements
were determined according to published guidelines with exclusion of nonspecific bands [2 I].
3. Results
Patients diagnosed with benzene-induced dysplasia exhibited a distinct set of characteristic features that both overlap with and can be distinguished from standard classifications of MDS. At the time of diagnosis in our laboratory, PB findings in these cases included pancytopenia (n = I), and cytopenias, singly or in combination (n= 16). The most consistent abnormal finding was lymphocytopenia (n= 14). Six subjects presented with normal or marginally normal blood counts (Table 2). All patients exhibited significant BM pathology including evidence of multilineage dysplasia which was characterized by macrocytic megaloblastic changes in granulocytic, eosinophilic as well as erythroid lineages and at all stages ofdevelopment. Stromal degeneration was also present in 12/23 cases. Most cases of benzene-induced dysplasia were hypocellular (17/23) with residual hematopoietic cells unevenly distributed throughout the BM. Dyserythropoiesis was commonly found and often severe (Figs. I and 2). Several features distinguished benzene-induced dysplasia from other previously defined subtypes of MDS including therapy related (t)MDS [16,22,23]. Prominent among these were the presence ofabnormal BM eosinophilic precursor cells (22/23 cases). These cells are reminiscent of those found in AML with the 16(p13;q22) chromosome abnormality [16] (Fig. 3). Hematophagocytosis, which is commonly associated with a poor prognosis in BM failure, was a particularly frequent and striking observation (16123 cases) (Fig. 4). Maturing myeloid cells and granulocytes also typically exhibited megaloblastic alterations and abnormal cytoplasmic morphology (18/23 cases) (Fig. 5). Finally, for a significant subset of cases there was a lack of concordance between the severity of pathology observed in the BM and the relatively mild or moderate abnormalities encountered in the PB (6/23 cases). This suggests that monitoring of the peripheral blood CBC may not accurately reflect the progression ofhematopoietic disease in patients previously exposed to benzene.
3.1. Clonal cytogenetic abnormalities in benzene-induced dysplasia
Reoccurring clonal genetic abnormalities are frequently
encountered in MDS, and have been suggested to play an
early or predisposing role in the development of the dis-
ease. Therefore, we analyzed BM cells from each subject for
evidence of clonal hematopoietic lesions. In contrast to the
overall frequency of cytogenetic abnormalities observed for
MDS in our laboratory (26%; n = 100), cytogenetic analyses
revealed no clonal abnormalities in any benzene poisoning
case in this series. The most frequent cytogenetic abnormal-
ities encountered in tMDS/tAML are
del(5q)-, and
del(7q-) which are found in greater than 70% of reported
R.D.1rons et al. / Leukemia Research 29 (2005) 1371-1380
--
Table 2 Characteristics ofPB and BM in benzene-induced dysplasia
Case ANC (106/1) ALC (106/1) LGL (%) PLT (109/1) Hgb (g/dl) Bone marrow
1375
Cellularity CD4/CD8 Ratio Stro Dysplasia
HP
Gran Ery Meg Eo
1240 2 1920 3 1250 4 1520 5 930 6 2980 7 1760 8 1590 9 3390 10 1650 11 1510 12 3140 13 2020 14 2380 15 2080 16 2270 17 2370 18 2950 19 2240 20 1400 21 2090 22 4000 23 1520
730 1620 1390 980 1530
190 340 2220 1740 1440 1160 823 2300 1600 1710 1780 1350 710 870 600 810 2850 990
27
15 28 20 24 25 32 40 41 46 30 42 41 28 30 32 28 18 18 32 22 33 ND
93.7
11.5
Nonn
0.24
122
11.9
Hypo
1.62
176
13
Hypo
0.92
200
13.5
Norm
0.76
61.8
15.9
Hypo
2.42
77.8
13.9
Norm
0.60
124
8.3
Hyper
0.64
146
13
Hypo
0.59
203
13.3
Hypo
0.71
168
12.9
Hypo
0.45
122
12.7
Hypo
0.43
92.7 11
Hypo*
0.42
133
11.8
Hypo*
0.97
174
15.2
Hypo
0.69
65.9 12
Hypo
0.83
137
13.8
Hypo
0.71
71.1
11.8
Hypo
0.37
113
12.8
Hypo
0.91
33.5
11.4
Hypo
0.20
84.1
12.9
Hypo
0.59
99.8
11.9
Hypo
139
275
14.7
Hyper*
0.88
147
13.2
Norm
0.50
N+ N ND
N +++
N +++
N ++ SA 0
N +++
SA ND
SA +++
FN ND SA +
QNS +++
QNS 0 SA +
SA +++
N +++ SA +++ SA +++
SA +++ SA ++'SA ~+
0 +++ SA /+
ND ND + ++ +t- O ++ ++ +++ 0 +++ 0
+++ -h-t
+0 +++ +t++ +0 00 00 +0 +0
+++ 0
+0 +0 +++ 0
~.J..+ (}
+0 +0 +0
+ +++ ++ -h-+ + ++ ++ -h-+ +++ ND +++ ++ +H +++ ++ +
+ -h-+ ++ + ND ND
+++ ND +++ ND
+H ND +++ ND ++ ++ ND +++ + +++ + ++ +H
++ +
++ + ++
ANC, absolute neutrophil count; ALC, absolute lymphocyte count; LGL, large granular lymphocytes (%ALC); PLT, platelet count; Hgb, hemoglobin; bone marrow cellularity was estimated from the core biopsy or the aspirate' (e.g. hypo-hypoplastic [<40% cellularity], norm-normal [40-60% cellularity] and hyper-hyperplastic [>60% cellularity]; BM lymphocyte CD4/CD8 ratios as determined by flow cytometry; Stm, stroma; SA, focal serous atrophy; FN, fibrinoid necrosis, 0, stromal cells were absent or too rare to evaluate; dysplasia was estimated for granulocytic (Gran), erythroid (Ery), megakaryocytic (Meg) and eosinophilic (Eo) lineages and scored based on the percentage of lineage~specific cells involved, ND [none detected], + [lO-50%}, ++ [50-70%], or +H [>70%]). 0, cells of individual lineage were absent or too rare to evaluate for dysplastic changes. HP, hematophagocytosis, was scored as not detected (ND) present (+), moderate (++) or severe (+++). Reference ranges: ANC (2000-7000 x 10611); ALC (1600-6000 x 106/1); LGL (5-15%); PLT (100-300 x 10911); Hgb (12-16 g/dl); CD4/CD8 (0.72-2.56) [55].
Fig. 1. Erythroid dysplasia and dyserythropoiesis in benzene-induced dysplasia. Abnormal erythroid cells exhibit megaloblastic abnormalities and abnormal nuclear morphology including nuclear bridging. BM aspirate slides stained with Wright-Giemsa (original magnification 1000x).
1376
R.D. Irolls et al. / Leukemia Research 29 (2005) /371-1380
Fig. 2. Prominent dyserythropoiesis in a core biopsy from a representative patient with benzene-induced dysplasia. The most frequent dyserythropoietic changes in H&E stained sections are bizarre budding of nuclei in erythroid precursor cells. Core biopsy section stained with Hematoxylin-Eosin (original magnification IOOOx).
Fig. 3. Abnormal eosinophilic precursor cells in benzene-induced dysplasia. Abnormal eosinophils exhibit megaloblastic nuclear abnormalities, nuclear hypersegmentation and atypical giant basophilic and eosinophilic cytoplasmic granulation. BM aspirate slides stained with Wright-Giemsa (original magnification 1000x).
cases [24,25], and some studies have suggested a similar pattern might exist for AML developing after chronic benzene exposure [10,26-28]. We also performed additional analyses for -7, 5q-, 11q23 and +8 structural abnormalities using FISH and observed no signals above background (data not shown). FLT3 mutations are the most frequently encountered genetic abnormalities in AML, commonly involving ITD or activation loop mutations in the TKD ofthe FLT3 gene [18,19,29]. However, no FLT3 mutations were observed in this series. These findings suggest that acquisition of cytogenetic or molecular abnormalities in benzene-induced dysplasia may be relatively late events in the neoplastic progression of the disease.
3.2. Benzene-induced dysplasia may involve an autoimmune process
The frequency and severity of lymphocytopenia, hemato, phagocytosis and eosinophilic dysplasia in benzene-induced dysplasia led us to examine additional immune cell parameters. Patients with benzene-induced dysplasia exhibited relative increases in LGL (mean = 29.6%, n = 22) in PB and decreases in the ratio ofCD4+/CD8+ lymphocytes in the BM
(0.77 0.48, n = 23) (Table 2). These observations coincided
with demonstration of clonal and oligoclonal proliferations in BM T lymphocytes (14123 cases), including clonal rearrangements in V!3 TCR gene segments (n = 4), VO TCR gene segments (n = 6) and both V!3 and VO TCR segnlents (n = 4).
4. Discussion
The role of autoimmune mechanisms in the development ofMDS remains largely unexplored, although, evidence is accumulating to implicate immunologic abnormalities in the pathogenesis of the disease. Frequent findings in MDS include lymphocytopenia, inverted CD4/CD8 T cell ratios, increases in cytotoxic CD8+ T cells (CTL) and serum levels of inflammatory cytokines such as tumor necrosis factor a (TNF-a), and interferon -y (INF--y) [2], abnormal expression ofHLA-DR [30] and evidence of TCR gene rearrangements [31-34]. Positive clinical responses to immunosuppressive therapy with anti-thymocyte globulin (ATG) or cyclosporin A also have been reported in some patients with MDS [3,33,35], together with treatment-related decreases in both CD8+ T cell clones and T-LGL [32,36,37]. The role of environmental exposure in the evolution ofMDS is unknown, although it has been hypothesized that the pathogenesis ofMDS may involve
R.D. Irons et al. / Leukemia Research 29 (2005) 1371-1380
1377
Fig. 4. Hematophagocytosis in benzene-induced dysplasia. Activated histiocytic cells within the BM exhibit prominent phagocytosis of degenerating erythroid and granulocytic cells which is indicative ofan immuno-reactive inflammatory process. The histiocytes themselves do not appear atypical and generally exhibited a low nuclear cytoplasmic ratio with small nuclei containing condensed chromatin, BM aspirate slides stained with Wright-Giemsa (original magnification IOOOx).
damage to hematopoietic progenitor cells exposed to intrinsic or environmental toxic agents that might lead to immunologic suppression of cell growth and maturation [2,38]. Transient anemia, cytopenias and dysplasia frequently occur in BM toxicity during or immediately following exposure to toxic agents. This usually is not associated with persistent disease and therefore, is not generally considered to be MDS [39-41]. However, our findings show that prolonged chronic exposure to high concentrations of benzene results in the development of a distinct form of dysplasia that differs from commonly defined subtypes ofMDS and that can persist for years after cessation of benzene exposure.
Previous proposals to explain benzene carcinogenesis, including those from our laboratory, have presumed a role for
genetic injury in the origin ofbenzene-induced persistent toxicity and the development ofAML [28,42-44]. Alternatively, our current results suggest the possibility that an autoimmune process may precede the acquisition of frank structural cytogenetic abnormalities and may be a predisposing event in the development ofpersistent BM disease following benzene exposure. Histological manifestations of benzeneinduced dysplasia include multilineage dysplasia including severe dyserythropoiesis, stromal degeneration, alterations in BM T lymphocyte subsets, abnormal eosinophilic precursors and hematophagocytosis. Hematophagocytosis is associated with severe viral infection or inflammatory response and activation of immune cells [45]. Benzene-induced dysplasia is also accompanied by clonal and p6lyclonal proliferation ofT
Fig. 5. Dysplastic changes in granulocytes in benzene-induced dysplasia. The BM and PB in the case series typically contain maturing myeloid cells 'with megaloblastic, hypo-segmented (pseudo Pelger-Huett) or hypersegmented nuclei. In some instances abnonnal mitotic figures are present in granulocytes with mature cytoplasm. Cytoplasmic abnonnalities include protruding pseudopodia which often trails cell bodies and abnbnnal cytoplasmic granulation in which large granules were unevenly distributed in clusters or marginated directly beneath the plasma membrane. BM aspirate slides stained with Wright-Giemsa (original magnification 1000 x).
1378 R.D. Irons et al. I Leukemia Research 29 (2005) 1371-1380
lymphocytcs in the BM which is indicative of an active immune process and has been described in a variety of immune-related conditions involving suppression of
hematopoiesis including MDS [4,46,47], The function oha
T cell subsets is largely unknown, although increases in 'Y8 T cells also have been observed in patients with BM failure, have been shown to modulate eosinophilic inflammation in other tissues and are known to be activated by TNF-a [35,37,48,49]. In this study, TCR8 expansions were accompanied by evidence of corresponding expansion of TCRy gene rearrangements. However, confirmation of 'Y8 T eell subsets by heteroduplex analysis is required,
These observations indicate that previous chronic exposure to benzene is associated with the development of BM dysplasia, and suggest that a reaetive inflammatory process may be involved in the suppression of hematopoiesis in persistent BM failure following chronic benzene exposure. These findings further suggest the possibility that markers of immune activation or inflammation may prove useful in monitoring the development or progression of benzeneinduced dysplastic disease. Nevertheless, the role of altered immune regulation in the pathogenesis of benzene-induced dysplasia, as well as the identity of any putative antigens remain a mystery, The mechanisms of benzene-induced hematopoietic cell injury are not completely understood. However, a subpopulation of CD34+ BM cells that are responsive to granulocyte-macrophage colony-stimulating factor (GM-CSF) have been implicated as targets, Studies in our laboratory have shown that the benzene metabolite, hydroquinone, enhances cytokine-dependent clonal proliferation of a subpopulation of GM-CSF-responsive human CD34+ BM cells which appears to be mediated via the extracellular signal-regulated kinase/activation protein-l signaling pathway (ERKfAP-l) [50-53). Independently, hydroquinone also synergizes with TNF-a to produce apoptosis in human CD34+ hematopoietic progenitor cells (HPC) via a mechanism that involves the inhibition ofNF-KB [54],
In recent years occupational exposure to benzene in China has been significantly reduced with the current Chinese occupational exposure limit being 1,9 ppm as a time weighted average (TWA) with a short-term exposure limit (STEL) of 3.2 ppm. Despite these changes, exposures to high concentrations of benzene continue to occur, and subjects diagnosed with persistent BM dysplasia in this report represent only a small fraction of the individuals exposed to high concentrations of benzene in the facilities studied. Previous reports have suggested that genetic polymorphisms in metabolizing and detoxification enzymes may play a role in conferring susceptibility to benzene toxicity. However, preliminary results in our laboratory do not suggest a prominent role for these genetic variants in'the development ofbenzene-induced BM dysplasia, Evaluation of the influence of polymorphisms in other genes, such as TNF-a, on susceptibility to benzeneinduced BM dysplasia are ongoing in our laboratory. Continued characterization and follow-up of these subjects with be~zene:induced dysplasia may provide insights into early
events associated with the pathogenesis, clonal selection and progression ofpcrsistent BM disease, including MDS and its potential progression to AML.
Acknowledgments
This work was funded by a grant from the Benzene Health Research Consortium and was conducted in cooperation with the Shanghai Hematology and Pathology Societies. We would like to thank the patients and the physicians who participated in our study. The participating hospitals included Huashan Hospital, Xinhua Hospital, Long March Hospital, Huang Pu Central Distract Hospital, Renji Hospital, Ruijin Hospital, Huadong Hospital, Jin An Central Hospital, No, 1 People's Hospital, No, 5 People's Hospital, No, 6 People's Hospital, No, 9 People's Hospital, Yang Pu Central Hospital, Zha Bei Central Hospital, Shu Guang Hospital, Chang Ning Central Hospital, Tong Ji Hospital, Shong Jin Central Hospital, Zhong Shan Hospital, Railway Hospital, Rong Hua Hospital, Changhai Hospital, Occupational Disease Hospital, Jiading Central Hospital, 455 Hospital, Shidong Hospital, No. 1 Baoshall Hospital, and PutUQ Central Hospital. The authors gratefully acknowledge Dr. Philippa Marrack for helpful discussion. We would also like to extend appreciation to Allan Holsomback, and Mingde Ouyang for database management and Ann Louden, Junfang Xie and Jiamin Liu for manuscript and clerical assistance. None ofthe authors are employees of or have financial interests in any facility studied in this report, TW.A and YZ. are under subcontract to R.D.I. at UCHSC for technical expertise in industrial hygiene,
References
[I) Barrett AJ. Myelodysplastic syndrome-an example of misguided immune surveillance? Leuk Res 2004;28: 1123-4.
[2] Rosenfeld C, List A. A hypothesis for the pathogenesis of myelodysplastic syndromes: implications for new therapies. Leukemia 2000;14:2-8.
[3] Biesma DH, van den Tweel JG, Verdonck LF. Immunosuppressive therapy for hypoplastic myelodysplastic syndrome. Cancer 1997;79:1548-51.
[4) Matsutani T, Yoshioka T, Tsuruta Y, Shimamoto T, Ohyashiki JH, Suzuki R, et al. Determination of T-cell receptors of clonal CD8positive T-cells in myelodysplastic syndrome with erythroid hypo.plasia. Leuk Res 2003;27:305-12.
[5] RinskyRA, Smith AB, Hornung RW, Filloon TG, Young RJ, Okun AH, et al. Benzene and leukemia: an epidemiologic risk assessment. N Engl J Med 1987;316(17):1044-50.
[6] Vigliani EC, Saita G. Benzene and leUkemia. N Engl J Med 1964;271 :872-6.
[7] Aksoy M, Dincol K, Erdem S, Dincol G, Acute leukemia due to chronic exposure to benzene. Am J Med 1972;52:160-6.
[8J Fagioli F, Cuneo A, Piva N, Carli MG, Previati R, Balboni M, et al. Distinct cytogenetic and clinicopathologic features in acute myeloid leukemia after occupational exposure to pesticides and organic solvents. Cancer 1992;70:77-85.
[9] Cuneo A, Fagioli F, Pazzi r, Tallarico A, Previati R, Piva N, et al.
Morphologic, immunologic and cytogenetic studies in acute myeloid
R.D. lroils et al. / Leukemia Research 29 (2005) 1371-1380
1379
leukemia following occupational exposure to pesticides and organic solvents. Leuk Res 1992;16:789-96. [10] Golomb HM, Alimena G, Rowley JD, Vardiman JW, Testa JR, Sovik C. Correlation of occupation and karyotype in adults with acute nonlymphocytic leukemia. Blood 1982;60:404-11. [II] Ciccone G, Mirabelli D, Levis A, Gavarotti P, Rege-Cambrin G, Davico L, et a1. Myeloid leukemias and myelodysplastic syndromes: chemical exposure, histologic subtype and cytogenetics in a case-control study. Cancer Genet Cytogenet 1993;68:1359. [12] Browning E. Toxicity and metabolism of industrial solvents. London: Elsevier Publishing Company; 1965. [13] Greenburg L, Mayers MR, Goldwater LJ, Smith AR. Benzene (ben7.01) poisoning in the rotogravure printing industry in New York City, J lnd Hyg Toxicol 1939;21(8):395-420. [14] Goldwater LJ. Disturbances in the blood following exposure to benzol. J Lab Clin Med 1941;26:957-73. [15] Linel MS, Yin SN, Travis LB, Li CY, Zhang ZN, Li DG, et al. Clinical features of hematopoietic malignancies and related disorders among benzene-exposed workers in China. Environ Health Perspect 1996;104(Suppl. 6):1353-64. [16] Jaffe E, Harris N, Stein H, Vardiman 1. World Health Organization Classification of Tumours. In: Kleihues P, Sobin LH, Lyon, editors. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. France: IARC Press; 2001. [17] U.S. Department of I:Iealth and Human Services: Centers for Disease Control, National Institute for Occupational Safety and Health Aromatic Hydrocarbons: Method 1501. Schlecht, p, C. Third supplement to NIOSH manual of analytical methods (NMAM) 4th Cincinnati, OH National Institute for Occupational Safety and Health, DHHS (NIOSH) 2003. [18] Shih LY, Huang CF, Wang PN, Wu JR, Lin TL, Dunn P, et aL Acquisition of FLT3 or N-ras mutations is frequently associated with progression of myelodysplastic syndrome to acute myeloid leukemia. Leukemia 2004;18:466-75. [19] Bagrintseva K, Schwab R, Kohl TM, Schnittger S, Eichenlaub S, Ellwart JW, et al. Mutations in the tyrosine kinase domain of FLT3 define a new molecular mechanism of acquired drug resistance to PTK inhibitors in FLT3-ITD-transformed hematopoietic cells. Blood 2004;103:2266-75. [20] Yamamoto Y, Kiyoi H, Nakano Y, Suzuki R, Kodera Y, Miyawaki S, et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood 2001;97:14349. [21] van Dongen JJ, Langerak AW, Bruggemann M, Evans PA, Hummel M, Lavender FL, et al. Design and standardization of PCR primers and protocols for detection of. clonal immunoglobulin and T-cell receptor gene recombinations in suspect Iymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia 2003;17:2257-317. [22] Forni AVEC. Chemical leukemogenesis in man. Semin Hematol 1974;7:211-23. [23] Orazi A, Cattoretti G, Soligo D, Luksch R, Lambertenghi-Deliliers G. Therapy-related myeJodysplastic syndromes: FAB classification, bone marrow histology, and immunohistology of the prognostic assessment. Leukemia 1993;7:838-47. [24] Smith SM, Le Beau MM, Huo D, Karrison T, Sobecks RM, Anastasi J, et at Clinical-cytogenetic associations in 306 patients with therapy-related myelodysplasia and myeloid leukemia: the University of Chicago series. Blood 2003;102:43-52. [25] Pedersen-Bjergaard J, Andersen MK, Christiansen DH, Nerlov C. Genetic pathways in therapy-related myelodysplasia and acute myeloid leukemia. Blood 2002;99:1909-12, [26] Crane MM, Strom SS. Halabi S, Berman EL, Fueger JJ, Spitz MR, et al. Correlation between selected environmental exposures and karyotype in acute myelocytic leukemia. Cancer Epidemiol Biomarkers Prev 1996;5:639-44.
[27] Vandenberghe EA, Mecucci C, Delannoy A, Van den Berghe H. Deletion of 5q by t(5; 17) in therapy-related myelodysplastic syndrome. Cancer Genet Cytogenet 1990;48:49-52.
[28] Irons RD, Stillman WS. The process of leukemogenesis. Environ Health Perspect 1996; I 04: 1239-46.
[29] Ozeki K, Kiyoi H, Hirose Y, Iwai M, Ninomiya M,Kodera Y, et al. Biologi~ and clinical significance of the FLT3 transcript level in acute myeloid leukemia. Blood 2004;103:1901-8.
[30] Saunthararajah Y, Nakamura R, Nam JM, Robyn J, Loberiza
F, Maciejewski JP, et al. HLA-DRI5 (DR2) is overrepresented in myelodysplastic syndrome and aplastic anemia and predicts a response to immunosuppression in myelodysplastic syndrome. Blood 2002;100:1570-4. [31] Hamblin TJ. Immunological abnormalities in myelodysplastic syndromes. Semin Hematol 1996;33:150-62. [32] Saunthararajah Y, Molldrem JL, Rivera M, Williams A, StetlerStevenson M, Sorbara L, et al. Coincident myelodysplastic syndrome and T-cell large granular lymphocytic disease: Clinical and pathophysiological features. Br J Haematol 2001;112:195-200. [33] Shimamoto T, Iguchi T, Ando K, Katagiri T, Tauchi T, Ito Y, et al. Successful treatment with cyclosporin a for myelodysplastic syndrome with erythroid hypoplasia associated with T-cell receptor gene rearrangements. Br J Haematol 2001;114:358-61. [34] Kook H, Zeng W, Guibin C, Kirby M, Young NS, Maciejewski JP. Increased cytotoxic T cells with effector phenotype in aplastic anemia and myelodysplasia. Exp Hematol 2001;29:1270-7. [35] Jonasova A, Neuwirtova R, Cermak J, Vozobulova V, Mocikova K, Siskova M, et al. Cyclosporin A therapy in hypoplastic MDS patients and certain refractory anaemias without hypoplastic bone marrow. Br J Haematol 1998;100:304-9. [36] Molldrem JJ, Jiang YZ, Stetler-Stevenson M, Mavroudis D, Hensel N, Barrett AJ. Haematological response of patients with myelodysplastic syndrome to antithymocyte globulin is associated with a loss of lymphocyte-mediated inhibition of CFU-GM and alterations in T-cell receptor VIl profiles. Br J Haematol 1998;102:1314-22. [37] Maciejewski JP, Hibbs JR, Anderson S, Katevas P, Young NS. Bone marrow and peripheral blood lymphocyte phenotype in patients with bone marrow failure. Exp Hematol 1994;22: 1102-10. [38] Barrett 1. Myelodysplastic syndrome and aplastic anemia-diagnostic and conceptual uncertainties [comment]. Leuk Res 2000; 24:595-6. [39] Steensma DP, Tefferi A. The myelodyspla.~tic syndrome(s): a perspective and review highlighting current controversies. Leuk Res 2003;27:95-120. [40] Aul C, Germing U, Gattermann N, Minning H. Increasing incidence of myelodysplastic syndromes: real or fictitious? Leuk Res 1998;22:93-100. [41] Heaney ML, Golde DW, Myelodysplasia. N Engl J Med 1999;340: 1649-60. [42) Stillman WS i . Varella-Garcia M, Irons RD. The benzene metabolite, selectively induces 5q31-and-7 in human
bone marrow cells. Exp Hernatol 2000;28:169-76. [43] Smith MT, Zhang LP, Jeng M, Wang YX, Guo WH, Duramad P,
et al. Hydroquinone, a benzene metabolite, increases the level of aneusomy of chromosomes 7 and 8 in human CD34-positive blood progenitor cells, Carcinogenesis 2000;21:1485-90. [44] Smith MT, Zhang LP, Wang YX, Hayes RB, Li GL, Wiemels J, et at Increased translocations and aneusomy in chromosomes 8 and 21 among workers exposed to benzene. Cancer Res 1998;58:2176-81. [45] Jordan MB, Hildeman D, Kappler J, Marrack P. An animal model of hemophagocytic lymphohistiocytosis (HLH): CD8+ T cells and interferon gamma are essential for the disorder. Blood 2004; I 04:73543. [46] O'Keefe CL, Plasilova M, Wlodarski M, Risitano AM, Rodriguez AR, Howe E, et aL Molecular analysis of TCR clonotypes in LGL: a clonal model for polyclonal responses. J Immunol 2004; 172: 19609.
1380 R.D. Irons et ai. / Leukemia Research 29 (2005) 1371-1380
[47] Callan MF, Fazou C, Yang H, Rostron T, Poon K, Hatton C, et al. CDS(+) T-cell selection, function, and death in the primary immune response in vivo. J Clin Invest 2000;106: 1251-6l.
[48] Hahn YS, Taube C, Jin N, Sharp L, Wands 1M, Aydintug MK, et aL Different potentials of gamma delta T cell subsets in regulating airway responsiveness: V gamma 1+ cells, but not V gamma 4+ cells, promote airway hyperreactivity, Tb2 cytokines, and airway inflammation. J Immunol 2004;172:2894-902.
[49] Kanehiro A, Lahn M, Makela MJ, Dakhama A, Fujita M, Joetham A, et al. Tumor necrosis factor-alpha negatively regulates airway hyperresponsiveness through gamma-delta T cells. Am J Respir Crit Care Med 2001;164:2229-38.
[50] Irons RD, Stillman WS, Colagiovanni DB, Henry VA. Synergistic action of the benzene metabolite hydroquinone on myelopoietic stimulating activity of granulocyte/macrophage colony-stimulating factor in vitro. Proe. Natl Acad Sci USA 1992;S9:3691-5.
[51] Irons RD, Stillman WS. Cell proliferation and differentiation in chemical leukemogenesis. Stem Cells 1993;11 :235-42.
[52] Irons RD, Stillman WS. Impact of benzene metabolites on differentiation of bone marrow progenitor cells. Environ Health Perspect 1996;104(Suppl. 6):1247-50. Zheng 1H, Pyatt DW, Gross SA, Le AT, Kerzic PJ, Irons RD. Hydroquinone modulates the GM-CSF signaling pathway in TF-I cells. Leukemia 2004:1-9.
[54] Kerzic PJ, Pyatt DW, Zheng lH, Gross SA, Le A, Irons RD. Inhibition of NF-kappaB by hydroquinone sensitizes human bone marrow progenitor cells to TNF-a1pha-induced apoptosis. Toxicology 2003;187:127-37.
[55] Jiang W, Kang L, Lu HZ, Pan X, Lin Q, Pan Q, et al. Normal values for Cd4 and CdS lymphocyte subsets in healthy Chinese adults from Shanghai. C1in Diagn Lab Immunol 2004;11:811-3.
Int J Hematol (2009) 89:431-437
DOl 10,1007/s12185-009-0283-8
.-'
Adult precursor B lymphoblastic leukemia in Shanghai, China: characterization of phenotype, cytogenetics and outcome for 137 consecutive cases
Liming Bao . Sherilyn A. Gross' John Ryder' Xiaoqin Wang' Meirong Ji . Yan Chen' Yongchen Yang . Saijuan Zhu . Richard D. Irons
Received: 29 October 2008/Revised: 23 February 2009/ Accepted: I March 2009/Published online: 26 March 2009 The Japanese Society of Hematology 2009
Ahstract Acute lymphoblastic leukemia (ALL) accounts for 20~30% of adult leukemia in the West. However, detailed studies of B-cell-specific ALL in adult Asian populations are lacking. We diagnosed and characterized 137 consecutive cases of precursor B lymphoblastic leukemia (precursor B-cell ALL) presented to our laboratory in Shanghai using the WHO 2001 classification system. Patient clinical, phenotypic and cytogenetic characteristics were correlated with outcome. In contrast to Western studies, females (71) ou,tnumbered males (66) partly due to an increased prevalence of the CDlO- pro B-cell
phenotype. Females with a CD10- pro B-cell phenotype exhibited significantly better overall survival than males. The most common cytogenetic abnormality was the Philadelphia chromosome (PHlBCRJABL) which was found in approximately 37% ofthe cases. Cases of precursor B cell ALL lacking the PHIBCRJABL genotype exhibited a pronounced age-dependent, gender prevalence with a modal age in the sixth decade for females compared to the second decade for males. These findings suggest significant geographic heterogeneity in precursor B-cell ALL which may be of both etiological and therapeutic significance.
L Bao ' S. A. Gross, X. Wang Y. Chen Y. Yang S. Zhu ' R D. Irons (C8J) Fudan-Cinpathogen Clinical and Molecular Research Center, Institutes of Biomedical Sciences, Fudan University, Shanghai, China e-mail: richard.irons@cinpathogen.com
L Bao Division of Human Genetics, Cincinnati Children's Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH, USA
L Bao ' R, D. Irons Cinpathogen, Inc., Boulder, CO, USA
S. A, Gross R D, Irons Molecular Toxicology and Environmental Health Sciences Program, School of Pharmacy, University of Colorado Denver, Aurora, CO, USA
J, Ryder R D. Irons Department of Pathology, School of Medicine, University of Colorado Denver, Aurora, CO, USA
X. Wang' M. Ji Huashan Hospital, Fudan University, Shanghai, China
Keywords Precursor B-cell ALL . Ph chromosome ' BCRlABL . Cytogenetics' FISH, CDlO
1 Introduction
Acute lymphoblastic leukemia (ALL) represents approximately 20-30% of all leukemias in adults with a wellrecognized male predominance worldwide [1, 2]. The incidence of ALL increases around the age of 50 years "'''''''''''''8 2 cases per 100,000 people above 65 years of age [1]. The vast majority of adult ALL are of B cell
and are classified as precursor B-cell lymphoblastic leukemia (precursor B-cell ALL) by the World Health Organization [3]. Studies of adult precursor B-ce1l ALL in China are rare, with reports published as recently as 2005 indicating an extremely low prevalence of precursor B-cell ALL in Chinese populations [4]. Nevertheless, we report on a series of 137 consecutive cases of precursor B-cell ALL diagnosed in a single laboratory in Shanghai over a 4-year period. Our findings indicate that precursor B-cell ALL is not a rare disease in China and, in fact is second only to diffuse large B cell
<Q Springer
432 L. Bao et al.
lymphoma in prevalence among lymphoid neoplasms [5]. Characteristics of precursor B-cell ALL in Shanghai that differ from the Western experience include a female predominance and a relatively high proportion of complex cytogenetic abnormalities.
Although it is defined as a single disease ,entity under the WHO 2001 classification system, precursor B lymphoblastic leukemia is a heterogeneous disease that can be divided into the following four subgroups based on phenotypic differentiation: progenitor B-cell lymphoblastic leukemia (pro B-cell ALL); precursor B-cell lymphoblastic leukemia (precursor B-cell ALL); common B-cell lymphoblastic leukemia (common B-cell ALL); and mature B-cell lymphoblastic leukemia (mature B-cell ALL). Pro B-cell ALL constitutes about 11 % of ALL in adults in the West and predominately exhibit a CD19+ and CDlO- phenotype. Together, precursor B-cell ALL and common B-cell ALL comprise the vast majority of adult cases and co-express CD 19+ and CD 1O+. Mature B-cell ALL is thought to represent a more mature cell type, 80% of which also express CD20+ [1, 6, 7]. The t(9;22) translocation, resulting in the Philadelphia (PH) chromosome and the formation of ECRJABL fusion transcripts, is the most common cytogenetic abnormality occurring in adult precursor B-cell ALL with an incidence of 13-33% in Western studies [1, 6, 8-15]. A subset of PH chromosome positive (PHlBCRJABL+) precursor B-cell ALL frequently co-express the myeloid antigens CD13 or CD33 [16]. Patients with PHIBCRJ ABL+ precursor B-cell ALL usually do not respond well to conventional chemotherapy, but newer therapeutic alternatives employing tyrosine kinase inhibitors (e.g. imatinib mesylate) used in combination with stem cell transplantation have been ~hown to improve outcomes '[17-20]. The t(4;11) translocation involving llq23 also occurs in a small subgroup of adult precursor B-cell ALL cases, and is associated with a high leukocyte count and a CDlO- pro B-cell ALL phenotype [21]. Geographic heterogeneity in the incidence of genetic aberrations in leukemia has been reported [20, 22], but has not been investigated previously in precursor B-cell ALL in China [23].
Patients in our series were diagnosed in a single laboratory according to WHO 2001 criteria, and routinely analyzed by morphologic, immunohistochemical, flow cytometric, cytogenetic and molecular genetic techniques. Our results reveal significant differences for male:female prevalence in precursor B-cell ALL and a distinct female predisposition toward pro B-cell ALL relative to Western reports. Predictably PHlBCRJABL+ precursor B-cell ALL responded poorly to conventional chemotherapy and had shorter overall survival (OS) than PHlBCRJABL- precursor B-cell ALL.
2 Materials and methods
2.1 Patients
A total of 137 patients were diagnosed in series with precursor B-cell ALL in our laboratory in Shanghai, China, between July 2003 and July 2007 according to the WHO 2001 classification criteria [3]. The patients were at least 18 years old and referred from 28 hospitals in Shanghai. Informed consent was obtained according to the Declaration of Helsinki, 2004 and the NIH Common Rule (45CFR46). This study was conducted as part of the Shanghai Health Study and approved by the Colorado Multiple Institutional Review Board, the Cincinnati Children's Hospital Medical Center Institutional Review Board and the Ethic Committee of Fudan University in Shanghai, China.
2.2 Sample collection and clinical laboratory analysis
Peripheral blood, bone marrow aspirates, tissue and core biopsies were collected in conjunction with diagnostic procedures. Peripheral blood smears were obtained by finger stick, and bone marrow aspirates and core biopsies were obtained by Jamshidi needle extraction from the posterior iliac crest. Blood samples were collected by venipuncture and processed for routine CBC (Cell Dyne 3700, Abbott, Abbott Park, IL), viral serology (HCV and HIV) (Irnx, Abbott) and clinical chemistry for liver enzymes (LDH, ALT and AST enzymes) (COBAS, Integra 400 plus, Roche Diagnostics, Basel).
2.3 Morphology
Bone marrow and peripheral blood smears were prepared and evaluated for morphology using Hematoxylin-Eosin (H&E), Wright-Giemsa and Gomori trichrome stain preparations. Peripheral blood blast cell number was obtained from the peripheral blood smear and bone marrow blast cell number was obtained from a bone marrow aspirate smear. Blast cells in both smears were enumerated and presented as a percentage of the total number of cells observed. Morphology was independently evaluated by three of us (M.J., R.D.I., J.R.). Microscopic analysis was performed using Olympus BX5l bright field microscopes (Olympus Optical Ltd, Tokyo).
2.4 Cytogenetic and FISH analysis
Banding chromosome and FISH analysis were performed on diagnostic bone marrow or blood. Clonal criteria and descriptions of karyotype followed the recommendations of the International System for Human Cytogenetic
<Q Springer
Adult precursor B-cell ALL in Shanghai, China
433
Nomenclature (2005) [24]. For FISH analysis the dualfusion, dual-color BCRlABL probe was used (Vysis). Sample preparation and probe hybridization were processed following the manufacturer's recommendations. In each case, 500 cells were analyzed. The cut-off was determined using samples collected on 20 healthy individuals.
2.5 PCR analysis
Total RNA was extracted from diagnostic bone marrow or blood using the Qiagen QIAamp RNA Blood Mini Kit (Qiagen, Strassel, Germany) and cDNA was synthesized with the oligo(dT) and Moloney-murine leukemia virus reverse transcriptase RNase H (Promega, San Luis Obispo, CA). The conditions for PCR were modified from the method reported by Cross et al. [25]. Primers for the first round PCR were 5'GGACTTCTCCTCTGGCCAGTCCA3', 5'GGAGCTGCAGATGCTGACCAAC3' and 5'CACAGG CCCATGGTACCAGGAG3', and for the second PCR were 5'ACCGCATGTTCCGGGACAAAAG3', 5'ACAGA ATTCCGCTGACCATCAATAAG3', and 5'TGTTGACTG GCGTGATGTAGTTGCTTGG3'. The peR program started with an initial denaturing at 94DC for 3 min, then underwent 35 cycles at 94DC for 40 s, 59C for 40 s, and
noc for 40 s. A final extension reaction followed at noc for
5 min. The PCR products were analyzed by gel electrophoresis.
L-asparaginase 10,000 U/day, prednisone 60 mg/day then 30 mg/day) or VDCP (vincristine 2 mg/day, daunomycin 40 mg/day, cytoxan 1,000 mg/day, prednisone 60 mg/day then 30 mg/day) regimens. Once remission was achieved, patients received consolidation therapy consisting of either
VDLP, VDCP, Methotrexate 2-3 g124 h or VP16 + AraC
(Etoposide 150 mg/day plus cytosine arabinoside 150 mgt day). Bone marrow transplantation is not routinely employed for treatment of B-cell ALL in Shanghai, and only two patients had bone marrow transplant following reduction chemotherapy.
2.8 Statistical analysis
Differences in clinical and biological variables were mea-
sured
the Fisher's exact or chi-square test. In some
analyses, two-tailed hypothesis testing was used to deter-
mine differences between variables. OS distributions were
estimated using the Kaplan-Meier method with OS deter-
mined from the interval between the date of initial
diagnosis and death or loss of contact. The 95% confidence
intervals (CI) for survival probability estimates were
obtained by the method of Simon and Lee [26J. The dif-
ferences between survival curves were analyzed by log-
rank test. P < 0.05 is considered statistically significant.
3 Results
2.6 Immunophenotyping
Bone marrow aspirates were stained with a panel of fluorochrome-conjugated antibodies against CD45, CD34, CD1l7, DR, CD33, CD14, CD64, CD7, CDlO, CD19, CD16, CD13, CD4, CD8, CD3, CD2, CD56, CDllc, cCD3, cCD79a and cTdT. (Beckman Coulter, Hialeah, FL and Immunotech, Miami FL). Criteria for positive antigen expression included ;::20% for CD34, and;:: 10% for CDIO, CD13 and CD33 for cells gated in the blast cell popUlation. Positive selection for CD34 antigen expression was set at ;::20% since the blast cell cut-off for AML is set at 20% using World Health Organization 2001 criteria. As for positive expression of CDIO, CD13 and CDj3, we selected a ;:: 10% cut-off based on our flow cytometric analysis for gating of these antigens. Abnormal cells expressing ;::10% either CD 13 or CD33 were considered positive for myeloid markers.
2.7 Treatment regimen
Patients diagnosed as precursor B-cel1 ALL were given a reduction regimen using predominantly conventional VDLP (vincristine 2 mg/day, daunomycin 40 mg/day,
One-hundred and thirty-seven consecutive cases of precursor B-cell ALL were diagnosed in adult Chinese patients according to WHO 2001 criteria. More females presented with precursor B-cell ALL than males (71 and 66, respectively) which resulted in a male:female ratio of 0.92. The median age for females at presentation was 50 years (range 19-82) whereas the median age for males was 38 years (range 19-83). Conventional cytogenetic analysis was successful in 112 of 137 (81.8%) of precursor B-cell ALL cases. A total of 87 (77.7%) patients had clonal abnormalities, of which 42 (48.4%) had at least 3 aberrations and 25 (28.7%) presented with multiple clones. A total of 46 (41.1 %) cases were positive for the PH chromosome, of which 18 (36.7%) exrribited multiple clones, all due to karyotypic evolution. Seven cases without the PH . chromosome possessed multiple clones: 4 due to karyotypic evolution and 3 with multiple independent clonal abnormalities. An additional 4 cases (3.6%) were positive for the t(4; 11) translocation.
FISH analysis was performed on 127 (92.7%) patient samples including cases in which cytogenetic analysis was not informative and/or failed. A total of 47 (37.0%) were positive for BCRlABL rearrangements by FISH including two cases where cytogenetic analysis showed a normal
434 L. Bao et al.
karyotype. PHlBCRIABL status was assessed successfully in 134 of 137 patients either by cytogenetic analysis and/or FISH (Table I). Combining both cytogenetic and FISH results, the incidence of PHlBCRlABL+ was 36.6% in our series. Three additional cases, where both analyses failed, were considered unknown with regard to the genetic aberration and not included in the comparisons in Table 1. PCR analysis for BCRlABL was positive for 50 (37%) of 135 patients tested. Four PCR positive cases which did not concur with FISH and/or cytogenetics studies were considered inconclusive and were excluded from further analysis of PHlBCRlABL+ cases. Subsequent analysis of the 46 PHlBCRlABL+ precursor B-cell ALL cases revealed that 28 (60.9%) patients possessed the p190 isoform, 17 (37.0%) patients had the p210 isoform and one (2.2%) patient had both pl90 and p210. The p230 isoform was not found in our series. Clinical characteristics were compared between cases exhibiting either the pl90 or p210 BCRlABL isoform but no significant differences in clinical or biological parameters were observed between these two groups.
There was no difference in median age between PHI BCRlABL+ and PHlBCRIABL- precursor B-cell ALL patients, 43 and 45 years, respectively (Table 1). However, there was a significant difference in gender distribution between PHlBCRlABL+ and PHlBCRIABL- patients. The PHlBCRIABL+ abnormality was observed in more
Table 1 Clinical and biological features of Ph/BCRlABL+ and Ph/BCRIABL- precursor B-cell ALL
Features
PH/BCRI ABL+
PHlBCRJ ABL-
p
No. of patients
49
85
Age (yearst
43 (19-82)
45 (19-81)
Sex (male/female) (ratio) 29/20 (1.45) 35/50 (0.73)
WBC count (109/1) Platelets (109/1)
16.8 (0.4-384) 3.4 (0.4-422) 24.6 (9.4-352) 86.3 (10-242)
Hemoglobin (gil)
8.8 (3.2-14.2) 7.7 (3.1-13.2)
Serum LDH (lUll)
546 (122-6812) 365 (15-5347)
Blood blast (%)
56 (1-96)
20 (1-95)
Bone marrow blast (%) 85 (22-99) Immunophenotypeb
76.5 (20-96)
CD34+
48/49 (98.0%) 63/85 (74.1 %)
Myeloid markers
39/49 (79.6%) 38/85 (44.7%)
Cytogenetic abnorrnalitiesb
Complex karyotype
26/49 (53.1 %) 16/38 (42.1 %)
Multiple clones
18/49 (36.7%) 7/38 (18.4%)
t(4;11)(q21;q23)
0/49 (0%)
4/38 (10.5%)
NS NS 0.054 NS 0.0367 0.049 NS 0.0008 0.034
NS 0.0001
NS 0.01 0.02
Myeloid markers: expression of CD 13 and/or CD33
NS not significant a Median (range), b percent on available data
male patients than in female patients (ratio 1.45). However, for patients with PHlBCRIABL- precursor B-cell ALL, females outnumbered males (ratio 0.7). Patients with PHI BCRIABL+ precursor B-cell ALL also had lower platelet counts and higher percentage of blood and bone manow blasts (P < 0.05). Patients with PHIBCRIABL+ precursor B-cell ALL bad a higher mean WBC. Most of our precursor B-cell ALL patients showed blast cells with CD34+ expression but a higher proportion was observed among the patients also exhibiting PHlBCRlABL+ expression than in patients with PHlBCRIABL- precursor B-cell ALL (98.0 vs. 74.1 %). Similar to the Western experience, patients with PHlBCRlABL+ precursor B-cell ALL had more cells expressing either of the myeloid markers, CD 13 or CD33, and were more likely to have multiple clones than patients with PHlBCRIABL- precursor B-cell ALL. All cases were examined for CNS infiltration and there was no significant difference between PHlBCRlABL positive and negative genotypes (data not shown).
Eighty-five patients with precursor B-cell ALL who lacked the PHIBCRlABL genotype were further sub-divided into stages of phenotypic differentiation and compared for clinical and biological featureS (Table 2). Sixty-five cases were identified as common B-ce1l ALL (CD19+1 CD 10+) and 20 cases were classified as pro B-cell ALL (CD 19+ICD 10-). Although there was no difference in median age between these two groups, there were significant differences in both gender and age distribution. Females presented with CDIO- pro B-cell ALL twice as frequently as males (ratio 0.43) (P = 0.004) with a median age at presentation of 48 years for females and 39 years for males (NS). The translocation t(4; 11 )(q21 ;q23) was observed in four cases of the CDIO- pro B-ce1l ALL sUbtype and all four cases were female. Males and females were nearly equal in representation (ratio 0.8) for the CDIO+ common B-cell ALL subset (Fig. 1), but there was a significant difference in age at presentation between males
and females in this group (P = 0.008). The median age for
females presenting with CDIO+ common B-cell ALL was 55 years, whereas the median age for males presenting with this disease sUbtype was 34 years. No additional distinguishing clinical or biological features were observed between these two subsets of precursor B-cell ALL.
Treatment responses were assessed by OS with information available on 106 precursor B-cell ALL patients (38 patients PHlBCRIABL+ and 65 patients PHlBCRIABL-). The median survival time for cases of PHlBCRlABL+ and PHlBCRIABL- precursor B-ce1l ALL were 10 and 14.months, respectively (P = 0.036; Fig. 2). Predictably, PHlBCRlABL+ precursor B-ce1l ALL with the p210 had significantly shorter OS than PHlBCRlABL+ precursor B-ce1l ALL with p190 isoform (median survival 6 vs. 10 months, respectively; P < 0.05; data not shown). The
~ Springer
Adult precursor B-cell ALL in Shanghai, China
435
Table 2 Clinical and biological characteristics of PHIBCRIABLCDI0+ and CDIO- precursor B-cell ALL
Features
CDlO+
CDlO-
P
No. of patients
65
20
Age (years)"
44 (19-81)
43 (21-79)
NS
Sex (Male/Female)
29/36 (0.8)
6114 (0.43)
0.009
Median age (male/female)
34/55*
39/48
0.008*
WBC count (10911) Platelets (10911)
16.2 (0.3-348) 35.6 (0.07-130) NS
76.2 (0-242) 89.5 (0-324)
NS
Hemoglobin (gil)
8.2 (3-15.7) 11.8 (5.8-87) NS
Serum LDH (IUfl)
953 (15-18683) 1185 (147-3,568) NS
Blood blast (%)
32.5 (0-95) 38.5 (I-90)
NS
Bone marrow blast (%) 63.8 (12.5-96) 69.3 (38-93) Immunophenotypeb
NS
CD34+
42/65 (65%) 12120 (60%)
NS
Myeloid markers
29/65 (45%)
Cytogenetic abnormalitiesb
9/20 (45%)
NS
Complex karyotype 13/26 (50%) 3/12 (25%)
NS
Multiple clones
7/26 (23%)
0112 (0%)
0.0467
t(4;11)(q21;q23)
0/26 (0%)
4/12 (20%)
0.002
Myeloid markers:
of CD13 andJor CD33
NS not significant
*Significant for females
a Median (range), b percent on available data
Age and Gender Distribution for PhlBCR IABLPrecursor B-cell ALL in Shanghai, China
20
til dl
-~ 15
(.)
.o... 10
.d.cl
E5
:::I
Z
o
< 29 30-3~ 40-49 50-59 60-69 70-79 > 80
Age in Decades (years)
Fig. 1 Age and gender distribution for PH/BCRIABL- precursor B-cell ALL
median survival for females over the age of 40 years with CDlO+ common B-cell ALL was 22 months compared to males under the age of 40 years was 11 months, although this was not statistically significant. In spite of the fact that the total number of PHlBCRIABL- CDlO- pro B-cell ALL cases was relatively small, the median survival for males was well below that of females (4 vs. 18 months,
respectively; P = 0.0003; Fig. 3).
100
~-
'iii 80
>
.~
:::l
II)
e 60
-(j)
>
0
0 40
>.
E
e.c
.(cII
20
a.
'lL,
1'1-, p<O.05
L, I
" "I.,
I
I.,
-II_LL.L.._
,l_J..L.
'-'__ J..L, _P_h_/_B1C_.R..LI..A, BL- PBLL
I~ __ u
Ph/BCRlABL+ PBLL
0 0 10 20 30 40
Months after diagnosis
Fig. 2 Probabilities of overall survival in PHlBCRlABL+ precursor B-cell ALL (solid line) and PHlBCRIABL- precursor B-cell ALL (dotted line)
4 Discussion
When viewed In the context of previous epidemiology studies in China, the prevalence of adult precursor B-cell ALL in Shanghai was unexpected. Although this may in part be due to the WHO 2001 criteria used in diagnosis, the pattern of case referral is also likely an important factor. Because of disciplinary compartmentalization in China, study results based on diagnoses obtained either primarily or exclusively from histopathologic analysis would be expected to demonstrate a significant selection bias relative to those based on hematologic diagnosis. In contrast, our laboratory perfonned integrated hematopathology diagnoses, and the 28 participating referral hospitals represented a large cross section of the Shanghai medical community.
Our findings also revealed significant differences in the features and presentation of precursor B-cell ALL in Shanghai relative to Western studies. Given the common wisdom that there is a male predominance for worldwide, the slight female predominance in Shanghai is surprising. This can be attributed, in part, to a marked increase in prevalence for CDlO- pro B-cell ALL in females. Equally unexpected was the decreased probability of survival in males with this subtype. A significant increase in the median age of CDIO+ common B-ALL among women was also observed. However, this does not appear to correlate with a significant difference in survival at least in patients receiving conventional chemotherapy. Taken together; these results suggest significant geographic heterogeneity in precursor B-cell ALL which may be of both etiologic and therapeutic significance.
The majority of studies ofPHlBCRlABL in precursor Bcell ALL have been conducted on Western patients with
Springer
436 L. Bao et al.
100 ~!!-
(ij
.2c:: 80
::::I
If)
e 60
(J)
>
0
'0 40
e:~c
..1c\1
20
c..
0
.i
!
!
I
.!I
!
t_ ..,
I !
I
I
i
I
CD10- male
i
p<O.05
CD 10- female
0 10 20 30 40
Months after diagnosis
50
Fig. 3 Probability of overall survival in males (dotted line) and females (solid line) with CDlO- Pro B-cell ALL
only a few reports of Asian ALL patients appearing in the literature [12, 27, 28]. In this series PHlBCRlABL expression was detected in approximately 37% of our patients which is higher than previously reported in Asian ALL patients [12, 28]. Patient age distributions and geographic heterogeneity might contribute to some of these differences since the frequency of PHlBCRIABL+ precursor B-cell ALL increases demonstrably in elderly patients [29].
Several clinical characteristics observed among PHI BCRlABL+ precursor B-cell ALL patients in this series, such as lower platelet counts, higher blood and marrow blasts, higher hemoglobin level, and a male predominance are similar to those reported elsewhere [11, 27, 30]. High CD34 expression (98%) present in PHlBCRlABL+ precursor B-cell ALL also has been observed in previous studies 30], implying that the PHlBCRlABL+ cells may be derived from early progenitor cells. The proportion (18%) of the precursor B-cell ALL cases in our series that were positive for both myeloid antigens (CD13 and CD33) is also comparable with others [16]. However, we observed a increase in the percentage of PHlBCRIABL+ precursor B-cell ALL expressing either myeloid antigen than in PH/BCRIABL- precursor B-cell ALL (79.6 VS. 44.7%).
In this series patients were treated using predominantly conventional VDLP (vincristine, daunomycin, L-asparaginase, prednisone) or VDCP (VDLP + cytoxan) regimens. Consequently, the median OS for PH/BCRlABL+ and PHI BCRIABL- precursor B-cell ALL (10 vs. 14 months, resI;lectively) were similar to those reported prior to the introduction of the use of imatinib in combination with stem cell transplantation [J 1, J6] and unfavorable relative to those reported in recent studies in the West [18]. The development of effective therapeutic paradigms for
precursor B-cell ALL in China remains a challenge. Imatinib mesylate has not been commonly included in the treatment of precursor B-cell ALL in China, while haploidentical HLA-mismatched stem cell transplant is only available to a limited number of adult ALL patients in China.
5 Conclusions
The aim of this study is to characterize cases of adult
precursor B-cell ALL presented to our laboratory over a
4-year period. We diagnosed and characterized 137 con-
secutive cases using the WHO 2001 classification system
and compared them with respect to clinical, phenotypic
and cytogenetic characteristics with outcome. Although
adult precursor B-cell ALL in China has rarely been
reported, we found it to be the second most common
lymphoid neoplasm diagnosed in our laboratory.. The
therapeutic significance of PHlBCRlABL+ precursor
B-cell ALL is well established in the West. However, no
previous studies of the prevalence of PHlBCRlABL+
precursor B-cell ALL have been
in the Chinese
literature. In marked contrast to Western studies, females
. outnumbered males primarily due to an increased preva-
lence of a subset of precursor B-cell ALL that express a
CDlO- phenotype. Cases of PH/BCRIABL- precursor
B-cell ALL exhibited a pronounced age-dependent gender
prevalence with a modal age in the sixth decade for
females compared to the second decade for males. These
findings provide valuable insight into the previously
unrecognized but significant prevalence of adult precursor
B-cell ALL in China. Moreover, in the absence of cyto-
genetic characterization for PHlBCRlABL+ precursor
B-cell ALL in China, tyrosine-kinase-based therapeutic
modalities have not been implemented. This report pro-
vides the first description of the prevalence of adult
precursor B-cell ALL in a Chinese population and high-
lights therapeutic challenges to the management of this
disease that are unique to China.
Acknowledgments We would like to extend .our appreciation to Ann Louden for manuscript and clerical assistance and Anh Le, Qian Chen and Allan Holsomback for database management. We would also like to thank the participating hospitals including Huashan HOSpital, Xinhua Hospital, Long March Hospital, Huang Pu Central District Hospital, Renji Hospital, Ruijin Hospital, Huadong Hospital, Jin An Central Hospital, No.1 People's Hospital, No.5 People's Hospital, No.6 People's Hospital, 1\0. 9 People's Hospital, Yang Pu Central Hospital, Zha Bei Central Hospital, Shu Guang Hospital, Chang Ning Central Hospital, Tong Ji Hospital, Shong Jin Central Hospital, Zhong Shan Hospital, Railway Hospital, Rong Hua Hospital, Changhai Hospital, Occupational Disease Hospital, Jiading Central Hospital, 455 Hospital, Shidong Hospital, No. 1 Baoshan Hospital. and Putuo Central Hospital. This work was conducted as part of the Shanghai Health Study and was funded by the Benzene
Adult precursor B-cell ALL in Shanghai, China
437
Research Health Consortium consisting of British Petroleum, Amoco, Chevron Texaco, ExxonMobil, Conoco Philips and Shell Chemical Companies.
References
I. Cortes JE, Kantarjian HM. Acute lymphoblastic leukemia. A comprehensive review with emphasis on biology and therapy. Cancer. 1995;76:2393--417.
2. Velizarova M, Popova D, Hadjiev E, et al. Molecular-cytogenetic aberrations in E-cell adult acute lymphoblastic leukemia (BALL)-frequency and correlation with immunophenotype. Turk J Hematol. 2006;23:151-7.
3. Jaffe E, Harris N, Stein H, Vardiman 1. World Health Organization classification of tumours. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon, France: IARC Press; 2001.
4. Wang J, Young L, Win W, Taylor CR. Distribution and Zap-70 Expression of WHO Lymphoma Categories in Shanxi, China: a Review of 447 Cases Using a Tissue Microarray Technique. Appl Immunohistochem Mol Morphol. 2005;13:323-32.
5. Gross S, Zhu X, Bao L, et al. A prospective study of 728 cases of non-Hodgkin lymphoma from a single laboratory in Shanghai, China. Int J Hematol. 2008;88(2):165-73.
6. Gokbuget N, Hoelzer D. Recent approaches in acute lymphoblastic leukemia in adults. Rev Clin Exp Hematol. 2002;6: 114--41.
7. Lenonnand B, Bene MC, Lesesve JF, et al. PreE I (CDIO-) acute lymphoblastic leukemia: immunophenotypic and genomic characteristics, clinical features and outcome in 38 adults and 26 children. The Groupe D'etude Immunologique Des Leucemies. Leuk Lymphoma. 1998;28:329--42.
8. Annstrong SA, Look AT. Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol. 2005;23:6306-15.
9. Bloomfield CD, Secker-Walker LM, Goldman AI, et al. Six-year follow-up of the clinical significance of karyotype in acute lymphoblastic leukemia. Cancer Genet Cytogenet. 1989;40:171-85.
10. Dombret H, Gabert J, Boiron JM, et al. Outcome of treatment in adults with philadelphia chromosome-positive acute lymphoblastic leukemia-results of the prospective multicenter Lala-94 trial. Blood. 2002; 100:2357-66.
11. Fader! S, Kantarjian HM, Thomas DA, et al. Outcome of Philadelphia chromosome-positive adult acute lymphoblastic leukemia. Leuk Lymphoma. 2000;36:263-73.
12. Ko BS, Tang JL, Lee FY, et al. Additional chromosomal abnonnalities and variability of BCR breakpoints in philadelphia chromosome/BCR-ABL-positive acute lymphoblastic leukemia in Taiwan. Am J Hematol. 2002;71:291-9.
13. Larson RA, Dodge RK, Burns CP, et al. A five-drug remission induction regimen with intensive consolidation for adults with acute lymphoblastic leukemia: cancer and leukemia group b study 8811. Blood. 1995;85:2025-37.
14. Secker-Walker LM, Craig JM. Prognostic implications of breakpoint and linage heterogeneity in Philadelphia-positive acute lymphoblastic leukemia: a review. Leukemia. 1993;7:147-51.
15. Wetzler M, Dodge RK, Mrozek K, et al. Additional cytogenetic abnonnalities in adults with Philadelphia chromosome-positive
acute lymphoblastic leukaemia: a study of the cancer and leukaemia group B. Br J Haematol. 2004;124:275-88. 16. Gleissner B, Rieder H, Thiel E, et al. Prospective BCR-ABL analysis by polymerase chain reaction (RR-PCR) in adult acute Blineage lymphoblastic leukemia: reliability of RT-nested-PCR and compruison to cytogenetic data. Leukemia. 2001;15:1834--40. 17. de Labarthe A, Rousselot P, Huguet-Rigal F, et al. Imatinib combined with induction or consolidation chemotherapy in patients with de novo Philadelphia chromosome-positive acute lymphoblastic leukemia: results ofthe Graaph-2003 study. Blood. 2007;109: 1408-13. 18. Lee S, Kim YJ, Min CK, et al. The effect of first-line imatinib interim therapy on the outcome of allogeneic stem cell transplantation in adults with newly diagnosed Philadelphia chromosomepositive acute lymphoblastic leukemia. Blood. 2005;105:3449-57. 19. Piccaluga PP, Martinelli G, Rondoni M, Visani G, Baccarani M. Advances and potential treatment for Philadelphia chromosomepositive adult acute lymphoid leukaemia. Expert Opin BioI Ther. 2006;6:1011-22. 20. Johansson B, Mertens F, Mitelman F. Geographic heterogeneity of neoplasia-associated chromosome aberrations. Genes Chromosom Cancer. 1991;3:1-7. 21. Copelan EA, McGuire EA. The biology and treatment of acute lymphoblastic leukemia in adults. Blood. 1995;85: 1151-68. 22. Bao L, Wang X, Ryder J, et al. Prospective study of 174 de novo acute myelogenous leukemias according to the WHO classification: subtypes, cytogenetic features and Flt3 mutations. Eur J Haematol. 2006;77:35--45. 23. Kantarjian HM, TalpazM, DhingraK, etal. Significance of the P210 versus Pl90 molecular abnonnalities in adults with Philadelphia chromosome-positive acute leukemia. Blood. 1991;78:2411-8. 24. Shaffer LG, Tommerup N. An international system for human cytogenetic nomenclature (2005): recommendations of the International Standing Committee on Human Cytogenetic Nomenclature. Fannington, CT: Basel; Karger; 2005. 25. Cross NC, Melo JV, Feng L, Goldman JM. An optimized multiplex polymerase chain reaction (PCR) for detection of BCRABL fusion MRNAs in haematological disorders. Leukemia. 1994;8:186-9. 26. Simon R, Lee YJ. Nonparametric confidence limits for survival probabilities and median survival time. Cancer Treat Reps. 1982;66:37--42. 27. Ko BS, Tang JL, Tsai W, et al. Philadelphia chromosome-positive acute lymphoblastic leukemia in Taiwan. Ann Hematol. 2001 ;80:510-5. 28. Qiu JY, Zhu W, Zhang Y, et al. Cytogenetic and clinical study of Philadelphia chromosome positive adult acute leukemia. Chinese. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2005;13:358-63. 29. Houot R, Tavernier E, Le QH, Lheritier V, Thiebaut A, Thomas X. Philadelphia chromosome-positive acute lymphoblastic leukemia in the elderly: prognostic factors and treatment outcome. Hematology. 2004;9:369-76. 30. Gleissner B, Gokbuget N, Bruiram CR, et al. Leading prognostic relevance of the BCR-ABL translocation in adult acute B-lineage lymphoblastic leukemia: a prospective study of the Gennan multicenter trial group and confirmed polymeraBe chain reaction analysis. Blood. 2002;99: 1536--43.
~ Springer
Page I
I of 2 DOCUMENTS
Copyright 2007 Elsevier Ireland Ltd All Rights Reserved
Chemico-Biological Interactions
(200S) 172 ECHBOI 1 SI-92
March 10, 200S
SECTION: Pgs. SI-92 Vol. 172 No. I ISSN: 0009-2797
LENGTH: 5777 words
TITLE: Dithiocarbamates and viral IL-I0 collaborate in the immortalization and evasion of immune response in EBV-infected human B lymphocytes
HISTORY: Received: September 27,2007; Revised: November 12,2007; Accepted: November 14,2007
AUTHORS: Richard D. Irons (a) (b) (c) (d) (e) Richard.Irons@UCHSC.edu;Anh Tuan Le (b)
(a) Fudan-Cinpathogen Clinical and Molecular Research Center, Institutes of Biomedical Sciences and Department of Pathology, Fudan University, Shanghai, China
(b) Molecular Toxicology and Environmental Health Sciences Program, School of Pharmacy, United States
(c) The School of Pharmacy and Department of Pathology, School of Medicine, University of Colorado at Denver and
Health Sciences
Denver, CO, United States
(d) Cinpathogen, Inc., Boulder, CO, United States
(e) Cinpathogen, Shanghai, China .
BODY:
ABSTRACT
Epstein-Barr virus (EBV) is implicated in the development of a number of human malignancies including several
subtypes of non-Hodgkin lymphoma (NHL) [G. Pallesen, S.1. Hamilton-Dutoit, X. Zhou, The association of
Epstein-Barr virus (EBV) with T celllymphoproliferations and Hodgkin's disease: two new developments in the EBV
Field, Adv. Cancer Res. 62 (1993) 179-239]. Lymphoproliferative disease and
occurring in severely
immunosuppressed individuals. almost always involve EBV and have been extensively studied and modeled in vitro.
EBV has also been causally associated with some cases ofNHL occurring in otherwise immunocompetent individuals.
However, a direct role for EBV in the pathogenesis of neoplasms developing in the presence of an otherwise competent
immune system has not been established. We investigated potential interactions between dithiocarbamates (DTC), an
Page 2 Dithiocarbamates and viral IL-l 0 collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10, 2008
important class ofthiono-sulfur compounds, and EBV leading to immortalization of human B lymphocytes and evasion of cell-mediated immune response in culture. Primary lymphocyte cultures employing wild-type a.'1d recombinant EBV mutants were used to assess the respective roles ofDTC and viral genes in lymphocyte transformation and survival. Pretreatment ofEBV-infected human B lymphocytes with DTC directly enhanced transformation in the absence ofT cells (5nM) and independently increased survival oftransformed cells in the presence of competent autologous T cells (lOnM). Both DTC-induced transformation and immortalization ofEBV-infected B lymphocytes were dependent on the expression of viral IL-l O. These results provide a biological basis for studying collaborations between chemical and virus that alter lymphocyte biology, and provide a rationale for further molecular epidemiology studies to better understand the potential influence of these interactions on the development ofNHL and perhaps other viral-associated malignancies.
FULL TEXT
1 Introduction
Epstein-Barr virus is a [gamma]-herpes virus that infects and transforms B lymphocytes both in culture and in vivo,
maintaining a lifelong latent infection in humans that is controlled by cytotoxic T lymphocytes. EBV is virtually always
involved in the pathogenesis oflymphoproliferative disease (LPD) and immunoblastic B cell lymphomas associated
with severe immunosuppression, for which EBV-induced transformation ofB lymphocytes in culture in the absence of
competent T cells is recognized to be the in vitro counterpart
Early events in the infection and transformation ofB
lymphocytes by EBV are not completely understood, although EBV-induced transformation is thought to involve
activation of signaling pathways in normal B lymphocyte proliferation including the up-regulation of Bcl-2. [4-8]. EBV
is also implicated in the development of a subset of sporadic malignancies occurring in otherwise immunocompetent
individuals, including: nasopharyngeal carcinoma, leiomyosarcoma, gastric carcinoma, Hodgkin disease (HD), and
several subtypes ofNHL including those ofB, T and NK cell origin [1,9]. However, the precise role ofEBV in the
development and evolution of these neoplasms is unknown and there are no satisfactory paradign1s to explain the direct
role for EBV in the pathogenesis of neoplasms developing in the presence of an otherwise competent immune system.
The EBV genome encodes for 94 proteins, only about 10 of which are expressed in immortalized B cells, and with the possible exception of a single nuclear protein, EBV nuclear antigen-2 (EBNA2), there is no general agreement that expression of any particular gene is essential for B lymphocyte transformation [lOt. Newly infected B lymphocytes express a set of viral genes under the control ofEBNA2 [11-13]. However, in latent infected B lymphocytes, EBV gene expression is under the control ofEBNAI and may be restricted to only a single latent membrane protein, LMP2 [14]. The EBV BamBI C fragment open reading frame (BCRF1) encodes for a viral homologue ofIL-10 (vIL-10) that is reported by most but not all groups to be differentially expressed late in the EBV lytic cycle and occasionally in EBV-transformed or immortalized B lymphocytes [15-18]. The BCRFI protein can be detected 9-15h post infection, rapidly decreases thereafter [19] but is not usually expressed in latent EBV-infected B cells or most EBV-transformed tumor cell lines [20]. Human IL-lO (hIL-10) is a pleiotropic cytokine that is effective in the suppression of primary i111.111Une response and the development of innnunological tolerance. hIL-IO directly stimulates proliferation of EBV-infected B cells [21,22], prevents spontaneous death -of germinal center B cells [23], induces peripheral anergy in T lymphocytes, increases expression of MHC Class II and co-stimulatory 1110lecules on B lymphocytes and presenting cells and mediates evasion of local immune surveillance in EBV-associated neoplastic diseases [18,21,24,25]. With the exception of the N~terminal region of the peptide, vIL-l 0 shares considerable structural homology with its human counterpart [16]. However, vIL-10 is far less effective in stimulating MHC Class II expression on B lymphocytes and inhibiting IL-2 production by activated CD4+ cells [26,27]. Although antisense nucleotides for viL-lO mRNA are reported to block B lymphocyte transformation by EBV [18J, stuclies utilizing EBV recombinants indicate that the BCRF1 gene does not play an obligatory role in maintaining, latent EBV infection or inducing lymphocyte transformation, nor does it appear necessary for the continued growth of transformed cells in vivo or in vitro [28J.
Dithiocarbamates (DTC) are an important class of low molecular weight thiono-sulfur compounds with diverse
Page 3 Dithiocarbamates and viral IL-l 0 collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10,2008
biological activity that have been used in agriculture and the clinic to control fungi and bacteria and as accelerating agents in rubber a.'1d polymer manufacturing. DTC are employed worldwide as fungicides in agriculture, for the control of mold in a variety of products, including paint, leather, paper and fabrics, and are trace constituents of residues found in fruits, vegetables and other food products [29]. Epidemiology studies have reported generally inconsistent results for an association between occupational exposure to dithiocarbamates or their breakdown products and lymphoid neoplasms [30-33]. However, to date, no studies have evaluated specific multifactorial associations, including influences such as microbial infection, drug or chemical exposure, on the development ofNHL.
The biochemistry ofDTC is remarkably complex. They exert a variety of striking molecular changes in cell systems, the significance of which is not fully understood. These include the ability to: (1) oxidize protein thiols and inhibit hydroxyradical formation, (2) inhibit nuclear factor-kappaB (NF-[kappa]B) activation via mechanism(s) that notably do not involve either oxidation-reduction dependent modification of the NF-[kappa]B protein or interference with NF-[kappa]B-DNA binding, (3) induce AP-l-dependent cell differentiation and gene expression via de novo transcription of c-fos and c-jun[34] and (4) result in profound changes in some cells via a mechanism that involves alterations in the intracellular transport of copper ions [35-40]. The sensitivity and concentration-response between individual cell types differ widely but are remarkably consistent among various substituted DTC for which the dimethyldithiocarbamate (DMDTC) is a prototype.
Herein, we tested the premise that exposure of a virus-infected cell to a biologically reactive molecule can alter cell survival and transformation under conditions that independently do not result in immunosuppression. We used in vitro . cellular, molecular and recombinant approaches to analyze the effects ofDTC on naIve and EBV-infected peripheral blood mononuclear cells (PBMC), isolated B lymphocytes and reconstituted mixed autologous Band T lymphocytes. We found that treatment ofEBV-infected PBMC or purified B lymphocytes with DMDTC results in a marked increase in transformation and immortalization of lymphocyte clones apparently via independent processes that are both dependent on vIL-lO. These experiments also demonstrate that EBV-transformed clones from cells initially treated with DMDTC continue to be capable of inducing umesponsiveness and inhibiting reactivation of autologous T lymphocytes in the absence of chemical.
2 Materials and methods
2.1 Production ofEBV stock
The EBV producing cell line, B95-8 (American Tissue Culture Collection, Rockville, MD), was cultured in complete media consisting of RPMI 1640 containing 100IU/mL penicillin, 1Q0[mu]g/mL streptomycin, 2mM I-glutamine and 10% (v/v) heat inactivated fetal bovine serum (FBS) (Gibco/BRL, Grand Island, NY). Cells were maintained at a density of 1x 1Q6cells/mL in a 37C incubator with a humid atmosphere of 5% C02. For the production of viral stocks, cell were kept at a starting density of 5xl 05cells/mL and left for 14 days without the replacement of media. Supernatants from cultures were subsequently isolated and filtered through a 0.45[mu]m pore filter and lmL aliquots were stored in liquid N2.
2.2 Cell isolation and purification
Mononuclear cells used for the EBV infections were isolated from heparinized blood from healthy donors obtained with informed consent. Peripheral blood mononuclear cells (PBMC) were isolated by separation on a Ficoll gradient and washed twice with phosphate buffered saline containing 1% bovine serum albumin (PBS/BSA). Flow cytometric analysis of preparations of freshly isolated PBMC indicated that the B:T lymphocyte ratio ranged from 1:2.0 to 1:2.3. B and T lymphocytes were purified from the ficoll isolated mononuclear cells by incubating with an anti-CD19 (for B cells) or an anti-CD3 (for T cells) microbead conjugated antibody (Miltenyi Biotec, Auburn, CA) and passed through a magnetic separator column (Miltenyi Biotec). Percent purity of CD 19 or CD3 positive cells was measured by flow cytometrj (Epics 752,Coulter Electronics, Hialeah, FL) using anti-CD 19 (HIB19, Pharmingen San Diego, CA) or anti-CD3 (UCHT!, Pharmingen) monoclonal antibody (mAb) and determined to be greater than 95%.
---
Page 4 Dithiocarbamates and viral IL-l 0 collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10,2008
2.3 EBV infection and dithiocarbamate exposure
Mononuclear cells or B lymphocytes (1 x 107) were suspended in lmL of complete RPMI 1640 media and 1mL of EBV stock was added. Cultures were incubated at 37C for 2h in 5% C02 with occasional agitation. Cells were then pelleted and resuspended in complete media at a density of 1x 106cells/mL and then treated with various concentrations of DMDTC, DEDTC or PBS (Sigma, St. Louis, MO). For IL-l 0 neutralization experiments, 1[mu]g/mL goat anti-human IL-lO antibody (AF-2l7-NA, R&D Systems, Minneapolis, MN) was added.
2.4 Transformation and immortalization of EBV-infected cells
EBV-infected and/or DTC-exposed cells were plated using complete media into 96 well plates in triplicate at 1x 104cells/well or 1x 103cells/well for B lymphocytes and mononuclear cells, respectively. Plates were incubated at 37C, 5% C02 and half of the media changed weekly.Wells were counted for transformed clones by light microscopy after 4 weeks of culture. For the determination of immortalized clones, 12 positive wells were randomly selected, re-plated under limiting dilution conditions, subcultured for an additional 4 weeks and scored. Continual passage and subcloning of these selected clones beyond the additional 4 weeks were also performed to ensure that these LCLs were truly immortal.
2.5 ELISPOT assays for determination ofIL-IO producing cells
EBV-infected and DTC-exposed cultures were plated at 1xl 04cells/well onto 96-well Multiscreen HA nitrocellulose plates (MAHAS45 10, Millipore, Bedford, MA) previously coated overnight with sterile PBS containing JES3-9D7 mAb (1 [mu]g/mL) to capture both hIL-lO and vIL"10 producing cells. After overnight incubation, plates were washed with sterile PBS at room temperature and blocked by incubation with complete RPMI for 2h at 37C. Plates were then washed with PBS containing 0.05% Tween 20 to remove unbound cells. vIL-10 producing cells were detected with a biotinylated JES3-6Bll mAb, and total hIL-l 0+vIL-10 producing cells were detected using a biotinylated JES3-12G8 mAb after overnight incubation at 4C (Pha..'"ffiingen). Cells were visualized using a peroxidase-labeled streptavidin-HRP secondary reagent (Sigma). Cells secreting cytokine were enumerated following the color reaction using light microscopy by the appearance of spots. The IL-2 ELISPOT assay used the same procedure as above using an anti-IL-2 capture and detector antibody (Pharmingen).
2.6 T cell add-back assay
B lymphocytes were purified and infected with EBV as previously described. Donor matched CD3+ T cells were purified and added in increasing concentrations to the EBV-infected B lymphocyte culture wells. Mixed cultures were either assayed shortly after the addition of T cells by ELISPOT or propagated for an additional 3 weeks and then assessed for transformation and subsequent immortalization as previously described.
2.7 Recombinant vIL-IO EBV cultures
Lymphoblastoid cell lines containing recombinant wild type or vIL-lO-deleted EBV were obtained from Swaminathan et al. [28] and maintained in complete RPMI (RPMI 1640 supplemented with 10% FBS, 100IU/mL penicillin, 100[mu]g/mL streptomycin and 2mM I-glutamine). Lytic virus infection was induced by the addition of 20ng/mL 12-tetradecanoyl phorbol acetate (TPA), cells were incubated for 3 days, washed, irradiated with 90Gy via a cyclotron and plated with purified B lymphocytes in 96-well plates at a ratio of 5x 105 irradiated cells to 1x104 B cells (l50[mu]L/well). Co-cultivations were carried out in either complete RPMI media or media containing various concentrations of DMDTC. Transformed colonies were scored after 4-6 weeks.
2.8 Reverse transcription-PCR (RT-PCR)
Total RNA from primary B lymphocytes was isolated after 12,24,48 and 72h post infection. RNA preparations were treated with RNase-free DNase (Roche Diagnostics, Indianapolis, IN) for 30min at 37C. After inactivation of the
Page S
Dithiocarbamates and viral IL-l 0 collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10,2008
.-
enzyme, 1[muJg RNA was reverse transcribed (+RT; Superscript Plus; GibcolBRL) with random hexarners for 60min at 37C. Reverse transcription was omitted for control purposes where indicated (-RT). PCR with one tenth of the volume (2[muJL) was performed in buffer containing l.SmmollL MgC12, lOOpmol of each primer, 0.2mmollL final concentration of each dNTP, and O.S[mu]L Arnpli-Taq-polymerase (Fisher Scientific, Pittsburgh, PA) at a final volume of 50[mu]L in a 9600 GeneArnp thermal cycler (PerkinElmer, Norwalk, CT). The following PCR primers (IDT, Coraville, IA) were used:
* BCRF1: 5'-TGGAGCGAAGGTTAGTGGTCAC-3' and S'-ATGGTCTTTGGCTTCAGGGTCC-3' * LMPl: S'-GTGATTCTGACGAAGCCAGAG-3' and S'-CGTGGGGCGCCCCAGGCACCA-3' * EBNA2: S'-AGAGGAGGTGGTAAGCGGTTC-3' and 5'-TGACGGGTTTCCAAGACTATCC-3'
* [beta]-actin: S'-CG TGGGCCGCCCTAGGCACCA-3' and 5'-TTGGCC TTAGGGTTCAGGGGGG-3'.
Amplified bands were analyzed by electrophoresis through a 1.5% agarose and ethidium bromide stain.
2.9 Flow cytometric analysis
EBV-infected B cells (2xl06) were isolated at 48 and 72h post infection and subjected to flow cytometry analysis. Cells were washed in PBSIBSA and incubated with FITC conjugated antibodies for EBNA2 (clone PE2, Dako, Carpinteria, CA), BZLFl (clone BZ1, Dako) and viral capsid antigen p120 (VCA) (clone 2G2, Biogenesis, Kingston, NH) and analyzed using an Epics 7S2 (Coulter Electronics). A total of 10,000 cells were counted per individual analysis. For FCM analysis of EBNA2, incubation of anti-EBN.i\.2 a.'1tibody was carried out in the presence 0.1 % Tween 20. For FCM analysis of accessory molecule expression, human B lymphocytes were isolated at daily intervals over 1 week of culture and mean fluorescence intensity measured using anti-B-7.1 (CD80) [clone BB1], anti-B-7.2 (CD86) [clone 2331(FUN-l)], andHLA-DR [clone G46-6(L243)] (Pharmingen).
3 Results
3.1 Increased proliferation and immortalization ofEBV-infected B lymphocytes by DMDTC
Growth and transformation of B lymphocytes by EBV in vitro have long been used as a surrogate for the study of
immunoblastic transformation in vivo [41-44]. Therefore, we measured the influence ofDMDTC on transformation of
EBV-infected lymphocyfes in cultures of human PBMC and purified B lymphocytes. PBMC (containing both Band T
lymphocytes) or purified B cells were infected with EBV, treated with DMDTC or phosphate buffered saline (PBS) and
the outgrowth of colonies compared after 4 weeks. Pretreatment with DMDTC resulted in a significant dose-dependent
increase in the transformation ofB lymphoblasts in PBMCcontaining autologous T lymphocytes and in purified B
lymphocytes at concentrations as low as 10 and SnM, respectively
1). To determine the effects ofDMDTC on
lymphocyte immortalization we assessed the cloning efficiency of these colonies by subculturing cells under conditions
oflirniting dilution for an additional 4 weeks and again scoring colony formation. Immortalization ofEBV-transformed
lymphocytes was enhanced 16 fold in PBMC and over 40 fold in purified B lymphocytes. These results demonstrated
that DMDTC induced a marked increase in immunoblastic transformation in EBV-infected B cells and suggested that
while treatment ofEBV-infected cells with DMDTC increased lymphocyte proliferation it is arguably more potent in
inducing imrnortalization.
- ...
Page 6 Dithiocarbamates and viral IL-lO collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10, 200S
Fig. 1. Transformation and immortalization ofEBV-infected B lymphocytes treated with DMDTC. Human Ficoll-purified PBMC (A) or isolated B lymphocytes (B) were infected with B95-S EBV supernatants, treated with DMDTC or buffer, cultured for 4 weeks and colonies enumerated. Cells from resulting colonies were then subcultured under limiting dilution conditions for another 4 weeks and cloning efficiency expressed as the percent of immortalized colonies (%) for PBMC (C) or purified B lymphocytes (D). Results represent the average number of colonies per treatment group from triplicate cultures S.E.M. Asterisks indicate significant difference from buffer-treated cultures using Student t-test (P'.Amplified bands were analyzed by electrophoresis through a 1.5% agarose. gel and ethidium bromide stain.2.9 Flow cytometric analysisEBV-infected B cells (2x 106) were isolated at 24, 4S and 72h post infection and subjected to flow cytometry analysis. Cells were washed in PBS/BSA and incubated with FITC conjugated antibodies for EBNA2 (clone PE2, Dako, Carpinteria, CA), BZLFI (clone BZl, Dako) and viral capsid antigen p120 (VCA) (clone 2G2, Biogenesis, Kingston, NH) and analyzed using an Epics 752 (Coulter Electronics). A total of 10,000 cells were counted per individual analysis. For FCM analysis ofEBNA2, incubation of anti-EBNA2 antibody was carried out in the presence 0.1 % Tween 20. For FCM analysis of accessory molecule expression, human B lymphocytes were isolated at daily intervals over 1 week of culture and mean fluorescence intensity measured using anti-B-7.l (CDSO) [clone BEl], anti-B-7.2 (CDS6) [clone 233 1(FUN-I)], and HLA-DR [clone G46-6(L243)] (Pharmingen).3 Results3.1 Increased proliferation and immortalization of EBV-infected B lymphocytes by DMDTCGrowth and transformation ofB lymphocytes by EBV in vitro have long been used as a surrogate for the study ofimmunoblastic transformation in vivo [41-44]. Therefore, we measured the influence ofDMDTC on transformation ofEBV-infected lymphocytes in cultures of human PBMC and purified B lymphocytes. PBMC (containing both Band T lymphocytes) or purified B cells were infected with EBV, treated with DMDTC or phosphate buffered saline (PBS) and the outgrowth of colonies compared after 4 weeks. Pretreatment with DMDTC resulted in a significant dose-dependent increase in the transforn1ation of B lymphoblasts in PBMC containing autologous T lymphocytes and in purified B lymphocytes at concentrations as low as 10 and 5nM, respectively (Fig. 1). To determine the effects ofDMDTC on lymphocyte immortalization we assessed the cloning efficiency of these colonies by subculturing cells under conditions oflimiting dilution for an additional 4 weeks and again scoring colony formation. Immortalization ofEBV-transformed lymphocytes was enhanced 16 fold in PBMC and over 40 fold in purified B lymphocytes. These results demonstrated that DMDTC induced a marked increase in immunoblastic transformation in EBV-infected B cells and suggested that while treatment ofEBV-infected cells with DMDTC increased lymphocyte proliferation it is arguably more potent in inducing immortalization.Fig. l. Transformation and immortalization ofEBV-infected B lymphocytes treated with DMDTC. Human Ficoll-purified PBMC (A) or isolated B lymphocytes (B) were infected with B95-S EBV supernatants, treated with DMDTC or buffer, cultured for 4 weeks and colonies enumerated. Cells from resulting colonies were then subcultured under limiting dilution conditions for another 4 weeks and cloning efficiency expressed as the percent of immortalized colonies (%) for PBMC (C) or purified B lymphocytes (D). Results represent the average number of colonies per treatment group from triplicate cultures S.E.M. Asterisks indicate significant difference from buffer-treated cultures using Student t-test (p<0.05). Data is representative of lout of 6 independent experiments performed using PBMC, and lout of 8 independent experiments using isolated B lymphocytes. Cells for each experiment were obtained from different donors (n=14).
3.2 The kinetics of viral gene expression in primary EBV-infected B lymphocytes
To evaluate differences in early EBV gene expression that might correlate with DMDTC-induced lymphocyte transformation, we inoculated primary B lymphocytes with supernatants from EBV-producing B95-S cells, treated the cultures 2h later with DMDTC or PBS alone and then measured viral gene- and protein-expression using flow cytometry and RT-PCR techniques (Fig. 2). Gene products associated with both lytic (BZLFl, vIL-10) and latent (EBNA2) EBV infection were present 12h post infection with a latent pattern of gene expression consistent with lymphocyte transformation (EBNA2, LMP-1) evident by 48h. Increases in viral capsid antigen (VCA) were not observed at any time point (Fig. 2: AI, B 1), indicating that treatment-related differences in the number of viral-transformed cells were not due to an increased rate of virion production or lymphocyte infection. Biphasic exprcssion ofBCRFl (24-72h) was consistently observed in untreated cells infected with EBV, and treatment with DMDTC always resulted in expression ofvIL-lO at 4Sh post infection. However, DMDTC pretreatment did not result
Page 7 Dithiocarbamates and viral IL-10 collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10,2008
in observable early changes in the kinetics of expression of other EBV genes typically associated with either
transformation or lytic virion replication 2: B2). These findings suggest Lhat pretreatment with DMDTC
altered expression of vIL-I 0 in the absence of apparent
in latent EBV gene expression or viral replication.
Fig. 2. Kinetics of gene expression in EBV-infected primary B lymphocytes. B cells were harvested at intervals as
indicated (hours post-infection) and analyzed by flow cytometry or RT-PCR techniques. (A) Flow cytometric analysis
of2xl06 EBV-infected B cells treated with PBS (AI) or 100nM DMDTC (A2)
antibodies against: EBNA2,
BZLF-I and VCA (viral capsid antigen pI20). Values represent Mean+S.E.M.
(B) RT-PCR analysis of RNA
extracts from 1xl06 EBV~infected B cells treated with PBS (BI) or 100nM DMDTC (B2). Representative agarose gel
(n=6) of PCR products for EBNA2, LMP 1 and BCRF I is shown. Primers for the specific transcripts and PCR
conditions are indicated in Section 2.
3.3 The role ofvIL-lO in DMDTC-induced transformation ofEBV-infected B lymphocytes
We performed a series of experiments to evaluate the role of vIL-I 0 in DMDTC-induced transformation of
EBV-infected cells. First, we determined the effects ofDMDTC on vIL-lO producing cells using an ELISPOT assay
(Fig. 3A). Treatment ofEBV-infected B cells with DMDTC resulted in a significant increase in vIL-10 producing cells
that was not observed following DMDTC treatment of uninfected B lymphocytes. We also ascertained that addition of
neutralizing anti-IL-IO antibody functionally abrogated DMDTC-cnhanced growth transformation (Fig. 3B). We then
repeated the transformation experiments described in Fig. 1 using recombinant virus techniques. Freshly isolated
purified B lymphocytes were infected with strains ofEBV containing either a 3.3kb deletion between bp 9535 and
12870 that spans the entire BCRFI open reading frame or a recombinant wild-type (WT) virus [28] (Fig. 3C). Cultures
treated with and without DMDTC (1" 1OOnM) were maintained for 4-6 weeks and scored for transformation. No
differences in the rate ofB lymphocyte transformation were observed in untreated cultures infected with either
recombinant EBV strain. In contrast, a marked increase in B cell transformation was observed in DMDTC treated
cultures infected with WT EBV but not the BCRF I-deletion mutant.
results demonstrated that the vIL-1 0 gene
was essential for DMDTC-enhanced transformation of EBV-infected B lymphocytes.
Fig. 3. The role ofvIL-10 in DMDTC enhanced B cell transformation. (A) The number ofvIL-lO secreting cells was determined at 24, 48 and 72h in EBV-infected or uninfected B lymphocytes treated with PBS or 100nM DMDTC. Asterisks indicate significant difference between DMDTC-treated and untreated EBV-infected cultures using Student t-test (p-6 weeks and scored for transformation. No differences in the rate ofB lymphocyte transformation were observed in untreated cultures infected with either recombinant EBV strain. In contrast, a marked increase in B cell transfonnation was observed in DMDTC treated cultures infected with WT EBV but not the BCRF1-deletion mutant. These results demonstrated that the vIL-I 0 gene was essential for DMDTC-enhanced transformation ofEBV-infected B lymphocytes.Fig. 3. The role of vIL-lO in DMDTC enhanced B cell transformation. (A) The number ofvIL-1 0
Page 8 Dithiocarbamates and viral IL-I 0 collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions lYfarch 10, 2008
secreting cells was determined at 24, 48 and 72h in EBV-infected or uninfected B lymphocytes treated with PBS or 100nM DMDTC. Asterisks indicate significant difference between DMDTC-treated and untreated EBV-infected cultures using Student t-test (p<0.05). (B) Transformation of EBV-infected andlor DMDTC-pretreated B lymphocytes was evaluated in the presence and absence of anti-vIL 10 antibodies. Colonies were scored after 4 weeks in culture. Asterisks indicate significant difference with and without addition of neutralizing anti-IL-I 0 antibodies using Student t-test (p<0.05). (C) Effect ofDMDTC treatment on purified B lymphocytes co-cultivated with irradiated lymphoblastoid cell lines containing BCRFI-deleted or WT EBV recombinant strains. Colonies were scored after 6 weeks in culture. Error bars represent S.E.M. (n=3). Asterisks indicate significant difference from buffer-treated cultures using Student t-test (p<0.05).
3.4 DMDTC pretreatment ofEBV-infected B cells enhanced their ability to inactivate autologous T cells
Our experiments indicated that DMDTC treatment directly enhanced transformation of EBV-infected B cells via a mechanism that was mediated via vIL-l O. Treatment~related increases in B lymphocyte immortalization occur in the
presence ofT cells at concentrations ofDMDTC that are as much as 500 times lower than those that directly inactivate
human T lymphocytes [37]. However, vIL-IO alone is also known to abrogate the inhibitory capacity ofT cells
targeting EBV-induced B cell transformation [21]. Therefore we performed experiments to determine whether DMDTC
pretreatment ofB lymphocytes indirectly resulted in the inactivation of autologous T cells. EBV-infected purified
human B lymphocytes were cultured under limiting dilution conditions with DMDTC for 7 days, washed, and then
reconstituted with increasing numbers of autologous T lymphocytes previously unexposed to chemicaL The addition of
autologous T cells at any titer> 1: I effectively prevented the outgrowth of EBV-infected B cells in untreated cultures
4). In contrast, pretreatment ofB cells with DMDTC resulted in proliferation and outgrowth ofB cell clones even
in reconstituted cultures containing high ratios of T to B lymphocytes. Consistent with previous reports that different
substituted DTC share a common chemistry a..'ld biological effects, we repeated these
using
diethyldithiocarbarnate (DEDTC) and obtained identical results (data not shown).
4. Influence ofDMDTC pretreatment on EBV-infected B lymphocyte immortalization in the presence ofT cells. EBV-infected purified B cells were cultured for I week at a density of 500 cells per well in the presence of PBS or 100nM DMDTC. Cells were washed, varying numbers of autologous purified T cells added, cultured for an additional 4-6 weeks and scored for colonies. Symbols indicate the number of transformants per well from duplicate experiments. The ratio ofB:T cells: 500:0 (I), 500:500 (1:1), 500:1000 (1:2), 500:2000 (1:4), 500:4000 (1:8).
A number of studies provide evidence that peripheral T cell tolerance or anergy can be overcome by addition of exogenous IL-2 which temporarily restores CD4 cell responsiveness [21,45]. We investigated the influence of exogenous IL-2 on the dynamics ofCD4 cell activation and EBV-infected B cell transformation in DMDTC-treated and control PBMC. PBMC were infected with EBV, treated with 100nM DMDTC or PBS, cultured for 14 days and then supplemented with rhIL-2 or PBS. We confmned in initial experiments that purified untreated T and B lymphocytes do not secrete IL-IO or IL-2 under the culture conditions used in these experiments (data not shown). Therefore, we used the number ofIL-2-producing and vIL-lO-producing cells, as determined by ELISPOT assays, as indicators of the numbers of activated CD4 cells and EBV-infected B cells, respectively. DMDTC pretreatment ofEBV-infected cells resulted in a marked increase in vIL-I0-producing cells relative to untreated cultures ofEBV-infected cells (Fig. SA). Addition of exogenous IL-2 on day 14 completely ablated vIL-l O-producing cells in untreated cultures and also resulted in a delay and attenuation of vIL-l O-producing cell proliferation in DMDTC-pretreated cultures. The addition of
Page 9 Dithiocarbamates and viral IL-lO collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10,2008
exogenous IL-2 markedly increased the number ofIL-2-producing cells inEBV-infected cultures. However, DMDTC-pretreatment did not affect the number or kinetics of these cells (Fig. 5B). Peripheral tolerance induced by vIL-IO has been shown to involve direct paralysis ofB7-I-mediated co-stimulation and not down regulation ofMHC or B7 expression [46]. Using flow cytometry, we detennined that DMDTC pretreatment did not alter expression of HLA-DR, B-7.1 or B-7.2 in EBV-infected B cells over 7 days in culture prior to the addition ofT cells (data not shown). These findings are consistent with the previously described mechanism for vIL-I0 induction oflocal tolerance [25] and demonstrate that the continued presence ofDMDTC is not necessary for EBV-transfonned B lymphocyte evasion of cell mediated immune response.
Fig. 5. Exogenous IL-2 partially restores T lymphocyte response against DMDTC-treated/EBV-infected B
lymphocytes. FicoU-purified PBMC were infccted with
treated with 100nM DMDTC, cultured for 14 days and
then supplemented with PBS or 200 U rhIL-2; (A) vIL-l O-producing B cells. Asterisks indicate significant difference
compared with DMDTC pretreated cells without IL-2 supplementation using Student t test (p<0.01). Circle indicates
significant difference compared with EBV-infected cultures without DMDTC pretreatment or IL-2 supplementation
using Student t test (p<0.01); and (B) IL-2-producing T cells were enumerated by ELISPOT at 15, 17,21 and 28 days
post-infection. Data are expresscd as the mean S.E.M. for
cells (n=4). Asterisks indicate significant
difference compared with identical cultures without supplementation using Student t test (p<0.0 1).
4 Discussion
Despite intensive investigation, a unified understanding of the biology oflymphocyte transfonnation by EBV
remains elusive, and controversies persist with respect to the contribution of individual viral genes in mediating B
lymphocyte transfonnation or immune evasion. vIL-IO has been shown to enhance B cell survival both by directly
stimulating growth and differentiation as well as facilitating immune evasion by EBV-infected transfonned B cells in
vivo. Nevertheless, some previous studies have
that vIL-I0 is not an absolute requirement for lymphocyte
immortalization or survival [20]. Our experiments demonstrate that treatment of EBV-infected cclls with DTC results in
a marked increase in both B lymphocyte transfonnation and immortalization. Consistent with the previously
demonstrated dual roles for IL-I0 in enhancing B lymphocyte proliferation and promoting T cell anergy, our
experiments indicate that vIL-l 0 plays an obligatory role in mediating DTC-induced increases in transfonnation as well
as attenuation of T cell inhibition ofEBV-infected B lymphocytes. These findings suggest that transient exposure of B
lymphocytes toDTC early in the cycle ofEBV infection Can pennanently alter the regulation ofvIL~10 expression,
suggesting that B lymphocyte transfonnation and survival may be subject to modulation by environmental or
therapeutic agents.
However, the molecular basis for these effects remains unclear. Several laboratories including ours have reported that DTC directly suppresses cell-mediated immune response and T lymphocyte activation [33,35,37,47]. DTC are historically considered not to be mutagenic, although Soloneski et al. recently reported increases in chromosome aberrations in cells treated with relatively high concentrations of ethylene bis(dithiocarbamate) [48,49]. These effects occur at concentrations of DTC that are 200-500 times higher than those demoustrated to enhance transformation or immortalization ofEBV-infected B lymphocytes in these experiments. Independently, we have not observed increases in structural chromosome aberrations in banded chromosome analysis of immortalized human B lymphocyte clones produced in our studies (data not shown).
The mechanism(s) whereby DTC specifically alter the regulation and expressiou ofvIL-lO remain obscure, and very little is specifically known about the regulation ofvIL-lO in infected B cells. DTC are generally regarded as
Page 10 Dithiocarbamates and viral IL-l 0 collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10, 2008
prototype inhibitors of transcriptional activation ofNF-[kappa]B [50], and are implicated in both pro-oxidant radical scavenging and copper-dependent intracellular oxidation of protein thiols [35,51]. Transcription of hIL-l 0 is controlled by the constitutively expressed transcription factors, Sp 1 and Sp3 [52], the induction of which have been demonstrated to be sensitive to oxidation of critical protein thiols [53,54]. Alternatively, the half-life ofhIL-l 0 mRNA appears tobe predominantly determined by post-transcriptional signals [55]. Homeostatic regulation of the subcellular distribution of copper is highly orchestrated [56], and alterations in intracellular copper concentration have been demonstrated to alter post-translational gene expression via multiple mechanisms (57,58]. Taken together it is attractivc to hypothesize that DTC influence cell-specific gene expression ofvIL_lO via copper-dependent direct oxidation of protein thiols.
IL-IO has been implicated in the development of immune tolerance for a variety of human tumors and LPD that are
presumably mediated via cell-specific suppression of cell-mediated immune function, i.e. defective cytotoxic T-cell
response, induction of antigen-specific anergy and T lymphocyte unresponsiveness [45,59-63]. Exploitation of cellular
or viral IL-IO homologues by other intracellular pathogens appears to be a common mechanism of immune evasion
[64], and a number ofvIL-IO homologues have been identified including those encoded by
equine herpes
virus-type 2, and cytomegalovirus [64].
Over the past 20 years the incidence of sporadic B cell NHL steadily increased with almost a doubling of the
incidence between 1980 and 2000 by about 3-4% per year worldwide [65]. In the past few years the incidence ofNHL
has apparently plateaued [31]. An etiological role for EBV in the pathogenesis of a subset of human cancers in
non-immunosuppressed individuals, including cases of sporadic NHL and HD, has been repeatedly suggested [66-68],
and it has been widely speculated that dietary, iatrogenic or environmental factors may influence viral carcinogenesis
[9]. However, no direct biologically plausible mechanism has emerged to explain potential viral-chemical interactions
in otherwise immunocompetent individuals in which EBV-infected B cells are normally held in check by T lymphocyte
immunosurveillance [59]. The results of our studies reveal that exposure of human B lymphocytes to DTC at very low
concentrations produces enhanced production of vIL-l 0 that is capable of inducing EBV-mediated B lymphocyte
proliferation and immortalization in the presence of otherwise competent T cells. NHL is widely appreciated to be a
complex and multifactorial disease. Numerous epidemiology studies have variously implicated a wide range of possible
etiological associations between infectious agents, occupation, dietary factors, the environment and previous underlying
diseases. However, consistent statistically significant results have been observed for only a relatively small subset of
these [31]. Our results suggest the potential for collaboration between chemical and at least one
virus, EBV, in
the immortalization and immune evasion of human cells. These results provide a point of departure for further
molecular epidemiology studies to better understand the biological basis of chemical-biological interactions and their
potential influence on the development ofNHL and perhaps other viral-associated malignancies.
Acknowledgements
This work was supported in part by grants from the National Institutes for Health (NIH ES06258), the American Chemistry Council, the University of Colorado Cancer Center Flow Cytornetry Core (NIH grant 2 P30 CA 46934-15) and funds provided by one of us (R.D.L). The authors gratefully acknowledge Dr. Sankar Swaminathan for the generous
of recombinant EBV strains and Ann Louden for manuscript preparation.
REFERENCES:
G. Pallesen, SJ. Hamilton-Dutoit, X. Zhou; The association of Epstein-Barr virus (EBV) with T cell lymphoproliferations and Hodgkin's disease: two new developments in the EBV field; Adv. Cancer Res.; Vol. 62, (1993), pp. 179-239.
lA Thomas, N.A Hotchin, MJ. Allday, P. AmIot, M. Rose, M. Yacoub, D.H. Crawford; Immunohistology of J..j~'H"lll-JJ"'U virus-associated antigens in B cell disorders from immunocompromised individuals; Transplantation; Vol. 49, (1990), pp. 944-953.
Page 11
Dithiocarbamates and viral IL-l collaborate in the immortalization and evasion of immune response in EBV-infected human B lymphocytes Chemi-co-Biological Interactions March 10, 2008
[3]. J.A. Thomas, M.J. Allday, D.H. Crawford; immunocompromised individuals; Adv. Cancer
virus-associated lymphoproliferative disorders in (1991), pp. 329-380.
[4]. R.G. Caldwell, IE. Wilson, SJ. Anderson, R. Longnecker; Epstein-Barr virus Lmp2a drives B cell development and survival in the absence of normal B cell receptor signals; Immunity; Vo1.9, (1998), pp. 405-411.
[5]. O. Gires, U. Zimber-Strob1, R. Gonnella, M.
G. Marschall, R. Zeidler, D. Pich, W. Hammerschmidt;
Latent membrane protein 1 of Epstein-Barr virus mimics a constitutively active receptor molecule; EMBO J.; Vol. ] 6,
(1997), pp. 6131-6140.
[6]. S. Henderson, D. Huen, M. Rowe, C. Dawson, G. Johnson, A. Rickinson; Epstein-Barr virus-coded Bhrf! protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death; PNAS; Vol. 90, (1993), pp. 8479-8483.
[7]. I Finke, R. Fritzen, P. Ternes, P. Trivedi, KJ. Bross, W. Lange, R. Mertelsmann, G. Dolken; Expression of Bcl-2 in Burkitt's lymphoma cell lines: induction by latent Epstein-Barr virus genes; Blood; Vol. 80, (1992), pp. 459-469.
[8]. S. Gangappa, L.F.van Dyk, T.J. Jewett, S.H. Speck, H.W. Virgin; Identification of the in vivo role ofa viral Bcl-2; J. Exp. Med.; Vol. 195, (2002), pp. 931-940.
[9]. lARC, Other data relevant to an evaluation of carcinogenicity and its mechanisms, 70 (1997).
[10]. E. Kieff, A.E. Rickinson;
virus and its replication; B.N. Fields, D.M. Knipe, P.M. Howley
Editors; Fields Virology; Lippincott-Raven, Philadelphia (1996), pp. 2343-2396.
[11]. X.W. Jin, S.H. Speck; Identification of critical cis elements involved in mediating Epstein-Barr virus nuclear antigen 2-dependent activity of an enhancer located upstream of the viral Bambi C promoter; J. Virol.; Vol. 66, (1992), pp.2846-2852.
[12]. U. Zimber-Strobl, K.O. Suentzenich, G. Laux, D. Eick, M. Cordier, A. Calender, M. Billaud, G.M. Lenoir, G.W. Bomkamm; Epstein-Barr virus nuclear antigen 2 activates transcription of the terminal protein gene; J. Virol.; Vol. 65, (1991), pp. 415-423.
[13]. F. Wang, C. Gregory, C. Sample, M. Rowe, D. Liebowitz, R. Murray, A. Rickinson, E. Kieff; Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP 1 cooperatively induce CD23; J. Virol.; Vol. 64, (1990), pp. 2309-2318.
[14]. RJ. Tiemey, N. Steven, L.S. Young, A.B. Rickinson; Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state; J. Virol.; Vol. 68, (1994), pp. 7374-7385.
[15]. S. Mahot, A. Sergeant, E. Drouet, H. Gruffat; A novel function for the Epstein-Barr virus transcription factor EB l/Zta: induction of transcription of the hlL-lO gene; J. Gen. Virol.; VoL 84, (2003), pp. 965-974.
[16]. KW. Moore, P. Vieira, D.F. Fiorentino, M.L. Trounstine, T.A. Khan, T.R. Mosmann; Homology ofcytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFl; Science; VoL 248, (1990); pp. 1230-1234.
[17]. P. Vieira, R. de Waal-Malef'yt, M.N. Dang, K.E. Johnson, R. Kastelein, D.F. Fiorentino, J.E. deVries, M.G. Roncarolo, T.R. Mosmann, KW; Moore; Isolation and expression of human cytokine synthesis inhibitory factor eDNA clones: homology to Epstein-Barr virus open reading franle BCRFl; PNAS; Vol. 88, (1991), pp. 1172-1176.
[18]. 1. Miyazaki, R.K Cheung, H.M. Dosch; Viral interleukin 10 is critical for the induction ofB cell growth
Page 12 Dithiocarbamates and viral IL-lO collaborate in the immortalization andevasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10, 2008
transfonnation by Epstein-Barr virus; J. Exp. Med.; Vol. 178, (1993), pp. 439-447.
[19]. R. Touitou, C. Cochet, I. Joab; Transcriptional analysis of the Jjn~aeln-l:j virus interleukin-IO homologue during the lytic cycle; J. Gen. Virol.; Vol. 77, (1996), pp. 1163-1168.
[20]. J.P. Stewart, F.G. Behm, 1.R. Arrand, C.M. Rooney; Differential expression of viral and human interleukin-10 (IL-I0) by primary B cell tumors and B cell lines; Virology; Vol. 200, (1994), pp. 724-732.
[21]. M.T. Bejarano, M.G. Masucci; Interleukin-lO abrogates the inhibition of Epstein-Barr virus-induced B-cell transfonnation by memory T-cell responses; Blood; Vol. 92, (1998), pp. 4256-4262.
[22]. A.D. Stuart, J.P. Stewart, F.R. Arrand, M. Mackett; The Epstein-Barr virus encoded cytokine viral interleukin-1.0 enhances transfonnation of human B lymphocytes; Oncogene; Vol. 11, (1995), pp. 1711-1719.
[23]. Y. Levy, J.-c. Brouet; Interleukin-l0 prevents spontaneous death of genninal center B cells by induction of the bcl-2 protein; 1. CJin. Invest.; Vol. 93, (1994), pp. 424-428.
[24]. K. Ohshima, J. Suzumiya, M. Akamatu, M. Takeshita, M. Kikuchi; Human and viral inter1eukin-lO in
Hodgkin's disease, and its influence on CD4+ and CD8+ T lymphocytes; Int. 1.
Vol. 62, (1995), pp. 5-10.
[25]. S. Salek-Ardakani, J.R. Arrand, M. Mackett; Epstein-Barr virus encoded interleukin-l 0 inhibits HLA-c1ass I,
ICAM-I, and B7 expression on human monocytes: implications for immune evasion by
Virology; Vol. 304,
(2002), pp. 342-351.
[26]. Y. Liu, R. de Waal MaieiYt, F. Briere, C. Parham, 1.M. Bridon, 1. Banchereau, K.W. Moore, 1. Xu; The EBV Il-lO homologue is a selective agonist with impaired binding to the Il-lO reeeptor; 1. Immuno!.; Vol. 158, (1997), pp. 604-613.
[27]. S.L Yoon, B.C. Jones, N.J. Logsdon, M.R. Waiter, Same Structure; Different function crystal structure ofthe Epstein-Barr virus 11-10 bound to the soluble II-10rI chain; Structure; Vol. 13, (2005), pp. 551-564.
[28]. S. Swaminathan, R. Hesselton, 1. Sullivan, E. Kieff; Epstein-Barr virus recombinants with specifically mutated BCRFI genes; 1. Viro!.; Vol. 67, (1993), pp. 7406-7413.
[29]. Environmental Protection Agency, EPA compendium of registered pesticides (1974) Volume 1 of EPA
compendium of registered pesticides which is issued in 5 volumes each updated by continuing supplements and
cumulated irregularly. Item 473-B-3.
.
[30]. O. Nanni, D.Amadori, C. Lugaresi, F. Falcini, E. Scarpi, A. Saragoni, E. Buiatti; Chronic lymphocytic leukaemias and non-Hodgkin's lymphomas by histological type in farming-animal breeding workers: a population case-control study based on a priori exposure matrices; Occup. Environ. Med.; VoL 53, (1996), pp. 652-657.
[31]. D.D. Alexander, P.J. Mink, H.O. Adami, E.T. Chang, P. Cole, 1.S. Mandel, D. Trichopoulos; The non-Hodgkin lymphomas: a review of the epidemiologic literature; Int. 1. Cancer; Vol. 120, (2007), pp. 1-39.
. T.C. Wilcosky, H. Checkoway, E.G. Marshall, H.A. Tyroler; Cancer mortality and solvent exposures in the rubber industry; Am. Ind. Hyg. Assoc. 1.; Vol. 45, No. 12; (1984), pp. 809-811.
R.D. Irons, D.W. Pyatt; Dithiocarbamates as potential confounders in butadiene epidemiology; arClnOl':em:S1S; Vol. 19, (1998), pp. 539-542.
[34].1. Aragones, C. Lopez-Rodriquez, A. Corbi, P.G. Del Arco, M. L6pez-Cabrera, M.O. De Landazuri, J.M. Redondo; Dithiocarbamates trigger differentiation and induction ofCDllc gene through AP-1 in the myeloid lineage; J.
Page 13 Dithiocarbamates and viral IL-lO collaborate in the immortalization and evasion of immune response in EBV-infected
human B lymphocytes Chemico-Biological Interactions March 10,2008
BioI. Chern.; Vol. 271, (1996), pp. 10924-10931.
[35J. M.J. Burkitt, H.S. Bishop, L. Milne, S.Y. Tsang, G.1 Provan, C.S.I. Nobel, S. Orrenius, A.F.G. Slater; Dithiocarbamate toxicity toward thymocytes involves their copper-catalyzed conversion to thiuram'disulfides, which oxidize glutathione in a redox cycle without the release ofreactive oxygen species; Arch. Biochem. Biophys.; Vol. 353, (1998), pp. 73-84.
[36J. J.L. Shenep, W.T. Hughes, P.M. Flynn, P.K. Roberson, F.G. Behm, G.H. Fullen, S.G. Kovnar, K.P. Guito, T.O. Brodkey; Decreased counts of blood neutrophils, monocytes, and platelets in human immunodeficiency virus-infected children and young adults treated with diethyldithiocarbamate; Antimicrob. Agents Chemother.; Vol. 38, (1994), pp. 1644-1646.
[37]. D.W. Pyatt, 1 Gruntmeir, W.S. Stillman, R.D. Irons; Dimethyldithiocarbamate inhibits in vitro activation of primary human CD4+ T lymphocytes; Toxicology; Vol. 128, (1998), pp. 83-90.
[38]. L1 Yu, 1D. Park, E.S. Park, K.S. Song, K.T. Han, 1H. Han, Y.H. Chung, B.S. Choi, K.H. Chung, M.H. Cho; Manganese distribution in brains of Sprague-Dawley rats after 60 days of stainless steel welding-fume exposure; Neurotoxicology; Vol. 24, (2003), pp. 777-785.
[39]. C. Cereser, S. Boget, P. Parvaz, A. Revol; Thiram-induced cytotoxicity is accompanied by a rapid and drastic oxidation ofreduced glutathione with consecutive lipid peroxidation and cell death; Toxicology; Vol. 163, (2001), pp. 153-162.
[40]. V. Zenzen, E. Fauth, H. Zankl, C. Janzowski, G. Eisenbrand; Mutagenic and cytotoxic effectiveness ofzinc dimethyl and zinc diisononyldithiocarbamate in human lymphocyte cultures; Mutat. Res.; Vol. 497, (2001), pp. 89-99.
[41]. A. Ruhlmann, A. Nordheim; Effects of the immunosuppressive drugs CsA and FK506 on intracellular signalling and gene regulation; Immunobiology; Vol. 198, (1997), pp. 192-206.
[42]. W. Henle, V. Diehl, G. Kohn, H. Hausen, G. Henle; Herpes-type virus and chromosome marker in normal leukocytes after growth with irradiated Burkitt cells; Science; Vol. 157, (1967), pp. 1064-1065.
[43]. lH. Pope, M.K. Horne, W. Scott; Transformation of foetal human leukocytes in vitro by filtrates of a human leukaemic cell line containing herpes-like virus; Int. l Cancer; Vol. 3, (1968), pp. 857-866.
[44]. D.T. Purtilo, R.S. Strobach, M. Okano, lR. Davis; Epstein-Barr virus-associated lymphoproliferative disorders; Lab. Invest.; Vol. 67, (1992), pp. 5-23.
[45]. H. Groux, M. Bigler, lE. de Vries, M.G. Roncarolo; Interleukin-lO induces a long-term antigen-specific anergic state in human CD4+ T cells; l Exp. Med.; Vol. 184, (1996), pp. 19-29.
[46]. A. Muller, L. Schmitt, M. Raftery, G. Schonrich; Paralysis ofB7 co-stimulation through the effect of viral IL-lO on T cells as a mechanism oflocal tolerance induction; Eur. J. Immunol.; Vol. 28, (1998), pp. 3488-3498.
[47]. R.D. Irons, W.S. Stillman, D.W. Pyatt, Y. Yang, A. Le, D.L. Gustafson, lH. Zheng; Comparative toxicity of dithiocarbamates and butadiene metabolites in human lymphoid and bone marrow cells; Chern. BioI. Interact.; 135-136, (2001), pp. 615-625.
[48]. S. Soloneski, M. Gonzalez, E. Piaggio, M. Apezteguia, M.A. Reigosa, M.L. Larramendy; Effect of the dithiocarbamate pesticide zineb and its commercial formulation azzurro. 1. Genotoxic evaluation on cultured human lymphocytes exposed in vitro; Mutagenesis; Vol. 16, (2001), pp. 487-493.
[49]. S. Soloneski, M.A. Reigosa, M.L. Larran1endy; Effect of dithiocarbamate pesticide zineb and its commercial
Page 14
Dithiocarbamates and viral IL-l collaborate in the immortalization and evasion of immune response in EBV-infected hUman B lymphocytes Chemico-Biological Interactions March 10, 2008
formulation, azzurro. II. Micronucleus induction in immunophenotyped human lymphocytes; Environ. MoL Mutagen.; Vol. 40, (2002), pp. 57-62.
[50]. R. Schreck, B. Meier, D.N. Mannel, W. Droge, P.A. Baeuerle; Dithiocarbamates as potent inhibitors of
nuclear factor [kappa]B activation in intact cells; l Exp. Med.; Vol.
(1992), pp. 1181-1194.
[5\]. S. Orrenius, e.S.I. Nobel, D.l Van den Dobbe1steen, M.J. Burkitt, AF.G. Slater; Dithiocarbamates and the redox regulation of cell death; Biochem. Soc. Trans.; Vol. 24, (1996), pp. 1032-1038.
[52]. H. Naora, J.G. Altin, LG. Young; Tcr-dependent and -independent
mechanisms differentially
regulate Iymphokine gene expression in the murine T helper clone DI 0.g4.1; l Immunol.; Vol. 152, (1994), pp.
5691-5702.
[53]. C.K. Jung, K Y. Lee, Y. Kim, KHan, S.1. Shim, B.K. Kim, e.S. Kang; Epstein-Barr virus infection, drug resistance and prognosis in Korean T- and Nk-celllymphomas; Pathol. Int.; Vol. 51, (2001), pp. 355-363.
[54]. X. Wu, N.H. Bishopric, D.l Discher, BJ. Murphy, KA. Webster; Physical and functional sensitivity of zinc finger transcription factors to redox change; Mol. Cell. BioI.; VoL 16, (1996), pp. 1035-1046.
[55]. MJ. Powell, S.A. Thompson, Y. Tone, H. Wa1dmam1, M. Tone; Posttranscriptional regulation ofll-l0 gene expression through sequences in the 3'-untranslated region; 1 Immunol.; VoL 165, (2000), pp. 292-296.
[56]. M.M. Pena, 1 Lee, DJ. Thiele; A delicate balance: homeostatic control of copper uptake and distribution; 1 Nutr.; Vol. 129, (1999), pp. 1251-1260.
[57].1. Varela-Nallar, E.M. Toledo, L.F. Larrondo, A.L. Cabral, V,R Martins, N.e. Inestrosa; Induction of cellular prion protein gene expression by copper in neurons; Am. 1 PhysioL Cell Physiol.; Vol. 290, (2006), pp. C271-C281.
[58]. N. Shiraishi, H. Utsunomiya, M. Nishikimi; Combination ofNadph and copper ions generates proteinase K-resistant aggregates from recombinant prion protcin; l BioI. Chem.; VoL 281, (2006), pp. 34880-34887.
[59]. LM. Svane, M. Boesen, A.M. Engel; The role of cytotoxic T-Iymphocytes in the prevention and immune surveillance of tumors-lessons from normal and immunodeficient mice; Med. Oncol.; Vol. 16, (1999), pp. 223-238.
[60]. M.A Markiewicz, T.F. Gajewski; The immune system as anti-tumor sentinel: molecular requirements for an anti-tumor immune response; Crit. Rev. Oncogen.; VoL 10, (1999), pp. 247-260.
[61]. S. Radoja, AB. Frey; Cancer-induced defective cytotoxic T lymphocyte effector function: another mechanism how antigenic tumors escape immune-mediated killing; MoL Med.; VoL 6, (2000), pp. 465-479.
[62]. C.C. Nast, A. Moudgil, X.J. Zuo, M. Toyoda, S.C. Jordan; Long-term allograft acceptance in a
with
posttransplant Iymphoproliferative disorder: correlation with intragraft viral interleukin-l 0; Transplantation; Vol. 64,
(1997), pp. 1578-1582.
[63]. S.A Birkeland, K Bendtzen, B. Moller, S. Hamilton-Dutoit, H.K Andersen; Interleukin-l0 and posttransplant lymphoproliferative disorder after kidney transplantation; Transplantation; VoL 67, (1999), pp. 876-881.
[64]. S. Redpath, P. Ghazal, N.R. Gascoigne; Hijacking and exploitation ofll-lO by intracellular pathogens; Trends MicrobioL; VoL 9, (2001), pp. 86-92.
[65]. K. Garber; Lymphoma rate rise continues to baffle researchers; J. NatL Cancer Inst.; Vol. 93, (2001), pp. 494-496.
Page 15 Dithiocarbamates and viral IL-10 collaborate in the immortalization and evasion of immune response in EBV-infected
.- human B lymphocytes Chemico-Biological Interactions March 10,2008
[66]. B.E. Griffin; Epstein-Barr virus (EBV) and human disease: facts, opinions and problems; Mutat. Res.; Vol. 462, (2000), pp. 395-405.
[67]. H. Kanno, N. Naka, Y. Yasunaga, K. Iuchi, S. Yamauchi, M. Hashimoto, K. Aozasa; Production of the immunosuppressive cytokine interleukin-1 0 by Epstein-Barr-virus-expressing pyothorax-associated lymphoma: possible role in the development of overt lymphoma in immunocompetent hosts; Am. J. Pathol.; Vol. 150, (1997), pp. 349-357.
[68]. K.J. Flavell, P.G. Murray; Hodgkin's disease and the Epstein-Barr virus; J. Clin. Pathol. Mol. Pathol.; Vol. 53, (2000), pp. 262-269.
LOAD-DATE: February 22, 2008
-********** Print Completed **********
Time of Request: Wednesday, October 21, 2009 12:12:26 EST
Print Number:
1841:184049428
Number of Lines: 516
Number of Pages: 15
100MRC
Send To:
MONTAGNA, ANDREW LOCKS LAW FIRM PLLC THE CURTIS CENTER SUITE 720 EAST
The World Health Organization (WHO) classification of tumors of the hematopoietic and o' lymphoid tissues. J Vardiman, University of Chicago, Chicago, IL, USA
The WHO classification of myeloid and lymphoid neoplasms utilizes morphology, immunophenotype, genetics and clinical features to define disease entities of clinical significance. It is a "consensus" classification for which a number of experts have agreed on the classification and the diagnostic criteria. In general, the classification stratifies neoplasms according to their lineage (myeloid, lymphoid, histiocytic/dendritic cell) and distinguishes neoplasms of precursor cells from those comprised of functionally mature cells. Further subclassification is based on biologic, phenotypic, genetic, and clinical features. Five major subgroups of myeloid tumors are recognized: myeloproliferative neoplasms (MPN, comprised mainly of mature cells with effective proliferation), myeloid (and lymphoid) neoplasms with eosinophilia and abnormalities of PDGFRA, PDGFRB and FGFR1 (defined largely by the genetic abnormalities and significant eosinophilia), myelodysplastic/ mye!oproliferative neoplasms (MDS/MPN, comprised mainly of mature cells with both effective and ineffective proliferative components), myelodysplastic syndromes (IVIDS, immature and mature cells with ineffective proliferation), and acute myeloid leukemia (AML, comprised of blasts with impaired maturation). Genetic abnormalities play an important role as diagnostic criteria for further subclassification of some myeloid subgroups, particularly AML, in which a number of clinicopathologic entities are recognized that are associated with specific genetic rearrangements or mutations. Although therapy-related AML and MDS often have genetic defects identical to those found in de novo AML and MDS, therapy-related myeloid neoplasms are classified separately within the AML category to emphasize their unique clinical and biologic properties. Lymphoid neoplasms appear to recapitulate stages of normal B-, T-, and NK-cell differentiation and to some extent are classified according to the corresponding normal stage. Thus, neoplasms of B cells can be divided into those of precursor, pregerminal center, germinal center or post-germinal center B-cells. Because NK cells are closely related ' to T cells, neoplasms of these two cell types are often considered together, and broadly categorized as precursor T cell neoplasms or as peripheral T/NK cell neoplasms. Some lymphoid tumors, however, are recognized by unique clinical or biologic features, such as lymphomas associated with immunodeficiency states associated with immunosuppressive therapy or with aging.
Myelodysplastic syndrome (MDS): A case-case analysis of benzene exposure and clinical features using the WHO(2001)/(2008) ciiteiia fOi diagnosis. RD Irons a, SA GiOSS, XQ Wang, ALe, CYan, AR Schnatter, H Fu. a Fudan-Cinpathogen Clinical and Molecular Research Center, Institutes of Biomedical Sciences, Fudan University, Shanghai, China
We diagnosed and characterized the prevalence of hematopoietic and lymphoid disease for 2923 consecutive patients presenting at 29 hospitals from Aug 2003 to Jun 2007. Diagnoses were made by a single laboratory using WHO criteria based on morphologic, immunophenotypic, cytogenetic, FISH and molecular data. A total of 611 subjects (322 males/289 females) were prospectively diagnosed with MDS using WHO (2001) criteria. Update and re-evaluation of cases using MDS (2008) criteria resulted in 649 MDS cases. Refractory cytopenia with multilineage dysplasia (RCMD) accounted for 68% of total cases, refractory anemia with excess blasts (RAEB), 16.3%, refractory anemia (RA), 6.S% and IVIDS-unclassifiable (IVIDS-U), 4.S%, based on 2008 criteria. Subjects were administered questionnaires and information on previous disease, work histories and exposures to potential etiologic agents such as benzene (BZ) was obtained. A total of 80/649 (13.2%) were determined to have some BZ exposure. The frequency of clonal cytogenetic abnormalities in the total MDS series was 30%, the most common being +8 >del(20)q > -7 >-S , while the analogous frequency in BZ-exposed cases was only 22.S%. To further investigate the clinical features of IVIDS that may be associated with BZ exposure, we identified a subset of cases with high BZ exposure. These signal cases were matched by age and gender to cases with no known BZ exposure. When contrasting high versus no BZ exposure cases, we found a high odds ratio (OR) for WHO subtypes MDSU (OR = 6), followed by RAEB (OR = 2) and RCMD (OR = O.S). Bone marrow morphology consistent with multilineage dysplasia with abnormal
=eosinophils was strongly associated with BZ exposure (OR 42). Surprisingly, the relative risk of
clonal cytogenetic abnormalities was reduced for high BZ exposed cases (OR = 0.S6), reflecting the pattern in the total case series. (This work was supported by the Benzene Health Research Consortium).
A hospital-based case-control study of acute myeloid leukemia in Shanghai: Analysis of environm_ental and occupational risk factors by WHO subtypes. 0 Wong a, F Harris, H Fu, et al. a Applied Health Sciences, San Mateo, California, USA
The objectives of the study were: (1) to investigate and identify potential environmental and occupational risk factors of acute myeloid leukemia (AML), and (2) to explore the relationships between risk factors and AML subtypes according to the \lVorld Health Organization (WHO) classification of myeloid neoplasms. The investigation was 9 hospital-based case-control study consisting of 722 confirmed AML cases and 1444 individually gender-age-matched patient controls at 29 hospitals in Shanghai. A 17-page questionnaire was used to obtain information on demographics, medical history, family history, lifestyle risk factors, employment history, residential history, and occupational and nonoccupational exposures. Certain occupations of interest triggered a second questionnaire, which was occupation-specific and asked for more details about jobs, tasks, materials used and work environment. Exposure assessments were based on the questionnaires; on-site workplace investigations, data published in the Chinese literature, historical exposure measurements maintained by government health agencies, and expert opinions of a panel of local scientists who were familiar with workplaces in Shanghai. Risk estimates (odds ratios and 95% confidence intervals) of individual risk factors were calculated using conditional logistic regression models. A number of potential environmental and occupational risk factors were associated with an increased risk of AML (all subtypes combined) and/or individual subtypes; including home or workplace renovation, living on a farm, planting crops, raising livestock or animals, farm workers, metal workers, rubber and plastic workers, wood and furniture workers, printers, loading and unloading workers, automobile manufacturing, general construction, and food and drink industry (restaurants and other eateries). Exposures associated with an increased risk included berizene, metals, insecticides, herbicides, fertilizers, paints, glues and adhesives, and inks. Multivariate models were used to adjust for potential confounding exposures, and several potential risk factors were subsequently eliminated. The results of the investigation indicated that some risk factors applied to all or several subtypes (factors such as low-level education and living on a farm), while others were limited primarily to a singie subtype (such as the association between raising iivestock or animais and AML with multilineage dysplasia). Thus, some risk factors were subtype-specific. The difference in risk by subtype underscores the importance of the etiologic commonality and heterogeneity of AML.
A hospital-based case-control study of non-Hodgkin lymphoid neoplasms in Shanghai: Analysis of environmental and occupational risk factor by WHO subtypes 0 Wong a, F Harris, H Fu, et al. a Applied Health Sciences, San Mateo, California, USA
The objectives of the study were: (1) to investigate and identify potential environmental and occupational risk factors of non-Hodgkin lymphoid neoplasms (NHLN), and (2) to explore the relationships between risk factors and NHLN subtypes according to the World Health Organization (WHO) classification of lymphoid neoplasms. The investigation was a hospital-based case-control study consisting of 649 confirmed NHLN cases and 1298 individually gender-age-matched patient controls at 25 hospitals in Shanghai. A 17-page questionnaire was used to obtain information on demographics, medical history, family history, lifestyle risk factors, employment history, residential history, and occupational and non-occupational exposures. Certain occupations of interest triggered a second questionnaire, which was occupation-specific and asked for more details about jobs, tasks, materials used and work environment. Exposure assessments were based on the questionnaires, on-site workplace investigations, data published in the Chinese literature, historical exposure measurements maintained by government health agencies, al"]d expert opinions of a panel of local scientists who were familiar with workplaces in Shanghai. Risk estimates (odds ratios and 95% confidence intervals) of individual risk factors were calculated using conditional logistic regression models. A number of potential environmental and occupational risk factors were associated with an increased risk of NHLN (all subtypes combined) and/or individual subtypes; including home/workplace renovation, living on a farm, planting crops, raising livestock or animals, farm workers, fabric sewing and cutting workers, welders and sheet metal workers, masonry and plastering workers, product and chemical testing workers, toy manufacturing, agriculture industry, and beauty salon. Exposures associated with an increased risk included benzene, solvents, petroleum fuels, gasoline, metals, insecticides, herbicides, ferj:ilizers, and glues and adhesives. Multivariate models were used to adjust for potential confounding exposures, and several potential risk factors were subsequently eliminated. The results of the investigation indicated that some risk factors applied to all or several subtypes (factors such as home/workplace renovation, and fabric sewing and cutting), while others were limited primarily to a single subtype (such as the association between solvents and precursor 8-cell neoplasms). Thus, some risk factors were subtype-specific. The difference in risk by subtype underscores the importance of the etiologic commonality and heterogeneity of NHLN.
Influence of benzene exposure and other factors on metabolism and peripheral blood
parameters
in
moderately exposed workers in Shanghai, China.
AR
Schnatter
a ,
P
Kerzic,
Y Zhou, M Chen, M Nicolich, K Lavelle, T Armstrong, M Bird, F Hua, R Irons. a ExxonMobii Biomedical
Sciences, Inc., Annandale, NJ, USA
Benzene is an established leukemogen and bone marrow toxin yet the mechanism of these effects
is still not known. The metabolism of benzene is thought to playa key role in these effects. Whether
decrements in peripheral blood cells are also involved in marrow toxicity and leukemia is a matter of
debate. Recent studies on benzene's metabolism have suggested that: (a) lifestyle habits such as
smoking contribute to metabolite levels, (b) single nucleotide polymorphisms do not playa large role in
levels of metabolites, (c) metabolism is more efficient at .Iower doses, (d) there may be important shifts
in the proportion of metabolites over the range of exposures, and (e) toluene inhibits benzene
metabolite formation. Recent findings on peripheral blood indices have variously suggested that
lymphocytes, neutrophils or earlier, less differentiated cells may be more sensitive to benzene
exposure. To test many of the findings which have resulted from recent studies, we studied 899
workers exposed to moderate levels of benzene in five factories near Shanghai China. Metabolite
analyses focused on a subset of. 208 workers in two factories for which five urinary benzene metabolites
and same-day personal benzene exposure measurements were available. Benzene exposure was a
strong predictor of metabolite levels. Segmented regression models suggest that benzene
concentrations of 0.8 ppm are necessary to raise both hydroquinone and trans, trans muconic acid
metabolites above background levels, while higher concentrations are necessary to affect background
levels of phenol and catechol. Single nucleotide polymorph isms of key metabolizing and deactivating
enzymes had little effect on metabolite levels. Despite previous data suggesting inhibition of benzene
metabolism by toluene, in our data, toluene exposure showed a positive influence on metabolism,
although the joint distribution of benzene and toluene exposure was compromised. When we examined
metabolic efficiency across exposure, slightly increased metabolic efficiency was suggested for
exposures below 1 ppm, although the magnitude of this effect was less than that observed in previous
studies. In univariate analyses of peripheral blood counts, stronger effects for benzene exposure were
noted for decreased erythrocyte and neutrophil counts and an increase in mean corpuscular volume.
Further investigation of other blood parameters is ongoing.
Benzene an~ childhood leukemia. DW Pyatt a.b, S Hays, L Alyward. a Summit Toxicology, LLP, b University of Colorado Health Sciences Center, Schools of Public Health and Pharmacy, USA
Chronic exposure to high concentrations of benzene is an established cause of AML in occupationally exposed workers. Based on this well documented association, it is not unreasonable to assume that children could also get AML if they were exposed to comparable levels of benzene. Fortunately, reports of such exposures and subsequent AML development in children are non-existent. However, the question of whether Children can develop leukemia at far lower, environmental levels of benzene remains. The existing scientific evidence relevant to this question will be addressed. Leukemias are the most common malignancy in children under 15 years of age. The majority (-85%) of childhood leukemia cases are acute lymphoblastic leukemia (ALL), with the remainder being almost exclusively acute myeloid leukemia (AML). Chronic forms of leukemia, either myeloid or lymphoid are exceedingly rare in children. Acute infant leukemia occurs before the age of 1 and shares phenotypic features with both ALL and AML. At this point, the risk factors for childhood leukemia remain essentially unknown as established etiological factors such as genetic conditions, ionization radiation and certain chemotherapeutic agents can explain only a small portion of cases. As a result, efforts to identify other potential etiologies remain an active research area. From a biological, clinical and epidemiological point of view, childhood ALL and AML are distinctly different diseases. Nonetheless, many older epidemiology studies on childhood leukemia have combined both types into one etiological group which is strongly influenced by the predominant ALL cases. In contrast, newer studies have begun to segregate out these two main subtypes and are reporting that childhood AML and ALL do not typically share the same risk factors. Combining them into a single group complicates the interpretation of this literature and may even obscure potential etiological relationships. Most epidemiology studies specific to children have included one or more of the following exposure pathways for benzene: 1) direct exposure to the child (via a variety of sources); 2) maternal exposures during pregnancy or while breastfeeding; and 3) exposure to either parent before conception. These pathways are not mutually exclusive and frequently occur together. The timing of exposure (e.g. age of the child) has also been an important consideration. Unfortunately, very few studies contain quantified exposure information and many have no meaningful exposure estimates at all. The use of various surrogates. for exposure such as proximity to gas stations or traffic density makes interpretation very difficult, particularly with regard to chemical exposures; Parental exposures to benzene or other chemicals in the workplace and its potential effect in the offspring have also been assessed (with varying degrees of scientific rigor) in multiple studies. While there are a few positive findings, the collective literature does not indicate that exposure to environmental levels of benzene is related to an increased risk of childhood leukemia. Our understanding would be strengthened by additional studies that accurately characterize exposures as well as differentiate between the various forms of leukemias observed in children.
Benzene-initiated oxidative stress: Effects on embryonic signaling pathways. HJ Badham", SJ Renaud, J Wan, LM Winn. "Department of Pharmacology and Toxicology, Queen's University, Kingston, Ontario, Canada
Approximately 90% of childhood cancers are of unknown etiology; however, it is hypothesized that in utero carcinogen exposure may contribute. Epidemiological studies have correlated parental exposure to benzene with an increased incidence of childhood leukemias. HO'vvever, mechanisms of benzeneinduced carcinogenesis following in utero exposure remain unknown. We hypothesize that in utero exposure to benzene causes alterations in the redox sensitive signaling pathways involving c-Myb, Pim1, ERK, p38, and NF-kB via the production of reactive oxygen species (ROS) as a possible mechanism of in utero initiated carcinogenesis. Using a CD-1 mouse model we have shown increased oxidative stress in fetal tissue from embryos exposed in utero to benzene by measuring reduced to oxidized glutathione ratios, and increased levels of ROS in male fetuses using flow cytometry and the ROS sensitive fluorescent probe dichlorofluoroscein diacetate (DCFDA). In addition, using western blotting techniques we observed increased expression of fetal Pim-1, Pim-1 phosphorylation, c-Myb, and phosphorylated p38 (activated form) and lower protein levels of IKB-alpha, while phosphorylated ERK protein levels did not change. Interestingly, we found male fetuses more susceptible to benzene induced oxidative stress and alterations in embryonic signaling pathways, which is in agreement with the literature suggesting that males are more susceptible to benzene toxicity. Further studies evaluating the reason for this gender difference are ongoing.
Metabolic factors in susceptibility to benzene toxicity. DRoss, H Zhou, Department of Pharmaceutical Sciences, School of Pharmacy, University of Colorado, Denver, CO, USA.
Susceptibility to the toxic effects of benzene has been suggested to occur via variations in genes involved in benzene metabolism including cytochrome P450 2E1, epoxide hydrolases myeloperoxidase, glutathione-S-transferases and quinone reductases. However, genes involved in DI\lA repair, genomic stability and expression of cytokines and/or cell adhesion molecules have also been implicated in benzene susceptibility and an important role has also been suggested for p53 in influencing the response to benzene in animals. Consequently, individual susceptibility to benzene exposure in humans is likely to be multifactorial. Our work has focused on the quinone reductase NQ01 and the influence of the homozygous NQ01 *2 polymorphism, which results in a null NQ01 phenotype, on benzene toxicity. The null NQ01 phenotype has been reported as a susceptibility factor for occupational benzene poisoning and NQ01 plays an important metabolic role in 1,4-benzoquinone detoxification. However, NQ01 may also impact other pathways in addition to metabolism of quinones due to protein-protein interactions or other mechanisms related to NQ01 activity. NQ01 has been implicated in stabilization of p53 and in maintaining microtubule integrity. NQ01 in bone marrow is primarily expressed in stromal cells and endothelial cells in stroma express high levels of NQ01. Since endothelial cells represent one of the major niches which influence bone marrow stem cell function, we have utilized transformed human bone marrow endothelial cells (HBMEC) as a model system to investigate the effects of benzene metabolites. HBMEC function was adversely affected by treatment with hydroquinone resulting in inhibition of endothelial cell tube formation, an effect modulated partly by upregulation of chondromodulin 1. In addition, inhibition of NQ01 activity in HBMEC using suicide inhibitors of NQ01 resulted in deficiencies of E-selectin, ICAM-1 and VCAM-1 adhesion molecule expression after TNFa stimulation. These results demonstrate how the metabolic susceptibility factor NQ01 may influence other potential susceptibility pathways for benzene toxicity such as p53 and adhesion molecule expression (Supported by NIH grant ES09554).
How much does benzene contribute to the overall burden of cancer due to occupation? L Rushton a. L Fortunato, S Hutchings. a Imperial College London. UK
Work-related cancers are largely preventable. We are estimating the burden of occupationallyrelated cancer in Great Britain to identify agents, industries and occupations for targeting risk prevention. We estimate attributable fractions (AF) and numbers (AN) for cancer mortality and incidence for all cancers, agents and occupations classified as IARC group 1 and 2A carcinogens. Benzene is classified as a group 1 carcinogen i.e. there is strong human evidence. The AF requires knowledge of the risk of the exposure and the proportion exposed. Relative risks (RR) estimates for acute non-lymphocytic
=leukemia (ANLL) were obtained from published literature: (i) RR 2.47. 95% C11.38 - 4.07 (Rinsky et
a/. 2002 for industry sectors with high exposures (ii) RR = 1.32 (95%CI 0.49 - 2.88) (Lewis et a/. 2000)
for land transport (iii) RR = 2.17 (95%CI 0.9 - 5.2) (Collins et a/. 2003) for workers in industrial chemical
=manufacturing (iv) RR 1.11 (95%CI 0.3 - 2.83) (Bloemen et al. 2004) for industry groups with low
levels of benzene exposure. A latency of 0 - 20 years was assumed for leukemia and we defined the risk exposure period (REP) for deaths occurring in 2005 as 1986 - 2005. National data sources were used for estimating proportions exposed over the REP in different industry sectors, taking account of changing employment levels and employment turnover. Monte Carlo methods were used to obtain random error confidence intervals (CI). We estimate the AF for ANLL due to exposure to benzene as 0.26% (95%CI 0 - 4.9%) giving 5 attributable deaths (95% CI 0.103) and 8 attributable cancer registrations (95% CI 0.158). The wide confidence intervals reflect small RRs. For leukemia from all IARC 1 and 2A occupational carcinogens (benzene, ionising radiation, ethylene oxide, formaldehyde, 1,3,butadiene, non-arsenical pesticides) estimates are: AF 0.7% (95%CI 0 - 5.7). AN (deaths) 30 (95% CI 0 - 239), AN (registrations) 47 (95% CI 0 - 363). The estimated overall occupational burden in GB due to all cancers (24 different cancers) is 5.5% (8.5% men and 2.3% women) giving over 8,000 deaths and 14,000 registrations attributable to carcinogens at work. Of the 41 different carcinogens for which separate estimates were made, benzene is ranked 31. Our results might thus be interpreted as indicating that benzene should not be an immediate priority for health and safety strategic planning and that reasons other than burden are required for prioritising research effort in this area.
Benzene is associated with the development of severe but not moderate aplastic
anemia in Shanghai, China. SA Gross a.b, RD Irons, AR Schnatter, AT Le, J Ryder, WX Qin,
TW Armstrong, GB Copely. a Molecular Toxicology and Environmental Health Sciences Program,
School of Pharmacy, University of Colorado Denver, CO; b Fudan-Cinpathogen Clinical and Molecular
Research Center, Institutes of Biomedical Sciences, Fudan University, Shanghai, China.
Benzene is historically thought to be a cause of aplastic anemia (AA) in individuals exposed to high
concentrations, although quantitative epidemiology studies are rare. Herein, we report the findings of a
case control study of 137 consecutive patients diagnosed with AA in Shanghai, China over a 4 year
period. Diagnoses were made by a single laboratory and subjects were age- and gender- matched to
two hospital-based controls. Questionnaires were administered to all cases and controls, and
information obtained on previous disease, work histories and exposures to potential etiologic agents
such as benzene.. Subjects and their controls were further categorized into AA subtypes (moderate
(MAA) and severe (SAA and odds ratios (OR) were calculated for individual risk factors. The strongest
associations were observed for exposure to benzene and SAA (OR 3.12,95% CI1.12-8.65) and life on
a farm and MAA (OR 3.08, 95% CI 1.44-6,56). Using a Conditional Logistic Regression model for
analysis of multiple risk factors, consistent associations between the risk factors (l.&. benzene and life on
a farm) and variation in subtypes of AA (1&. SAA and MAA) emerged as the best explanations for the
=development of the disease (R2 10.1 % and 9.9%, respectively). These findings suggest that individual
subtypes of AA may have distinct etiologies, and while exposure to benzene poses a significant risk of
developing AA, the majority of cases of this disease remain unexplained. (This work was funded by the
Benzene Health Consortium as part of the Shanghai Health Study.)
I
Analysis of hydroquinone and catechol in peripheral blood of benzene-exposed workers. PJ Kerzic a, P Liu, P Pan, Y Zhou, AR Schnatter, RD Irons. a Fudan-Cinpathogen Clinical and Molecular Research Center, Institutes for Biomedical Sciences, Fudan University, Shanghai, China
We have developed a gas chromatography-mass spectrometry method for analysis of benzene (BZ) metaboiites in human urine and blood. Here we describe peripherai biood concentrations of hydroquinone (HQ) and catechol (CAT) in total, protein bound, and unbound (free) forms obtained from BZ-exposed factory workers and controls. Total and unbound metabolites were directly measured in independent experiments, while bound forms were calculated as [total]-[unbound]. In this subset of a larger study, breathing zone benzene, toluene, and xylene were measured for the duration of a workshift, and end-shift blood samples taken from 143 individuals. Potential lifestyle and environmental influences were assessed by questionnaire and bioassay, and single nucleotide polymorphisms in xenobiotic metabolizing enzymes NQ01, MPO, Cyp2E1, and GSTT1 were also analyzed for potential contribution to differences in blood metabolite concentration. Positive correlations were observed between same-day BZ exposure and total CAT, bound CAT, total HQ, and bound HQ (r>0.634, p<0.05 for all), when compared to controls, while unbound CAT and HQ did not positively correlate with BZ exposure. Nearly all of the metabolites found in blood were bound to protein (CAT 96-99+%, HQ 7892+%), and when the ratio of bound to unbound metabolites were compared in subsets of exposed workers, the increase in blood metabolite concentration was nearly all due to an increase in the proteinbound molecule. These findings suggest that a threshold for conjugation does not exist within. the exposure spectrum studied. Correlations between exposure and blood metabolite concentration among subsets defined by genetic and lifestyle differences are also presented. This method demonstrates the feasibility of analyzing benzene metabolites in human blood, and should allow for further investiga,tion of the health effects of benzene and its metabolites. [This work was supported by the Benzene Health Research Consortium].
Effect of hydroquinone on DNA double strand break and DNA-PKcs expression in HL-60
cells. MM Kong a, wr Song, H You, JH Sun, Q Ma, YY Bi. a School of Public Health, Wuhan
University, Wuhan, Hubei, China Hydroquinone (HQ), a reactive metabolite of benzene, is myelotoxic and leukemogenic in humans.
Carcinogenicity of HQ is dependent upon its conversion to reactive free radical species, such as semiquinone radical, in the bone marrow. Redox cycling of these radicals produces reactive oxygen species that damage DNA and induce DNA double strand breaks (DSBs). In mammalian cells, DSBs induce substantial phosphorylation of histone H2AX (y-H2AX) at sites of DSBs, a marker of DSB formation. DSBs are mainly repaired through the error-prone, non-homologous end-joining pathway (NHEJ). I\IHEJ requires theONA-dependent protein kinase (DNA-PK) that consists of two regulatory subunits (Ku70 and Ku80) and a catalytic subunit (DNA-PKcs). In this study, we investigated DSB formation in human promyelocytic leukemic HL-60 cells treated with HQ. Cells were treated with HQ of 10, 25, 50, or 100 ~M for 6, 18, or 24 h. y-H2AX foci formation was observed with fluorescent microscopy. Significantly higher amounts of y-H2AX were found in cells treated with 50 and 100 ~M HQ for 18 hand 24 h, respectively, indicating HQ induces DNA double strand breaks in concentration and time-dependent manners. To examine the DSB repair activity after HQ treatment, we analyzed the expression of DNA-PKcs in HL-60 cells at both transcription and translation leveis. Cells were treated with HQ as above. The results showed a dose and time dependent induction of DNA-PKcs, indicating increased DSB repair activities after HQ treatment. Our findings reveal a roje of HQ in the induction of DSB and DSB repair, both of which are relevant to HQ-induced myelotoxicity and leukemogenesis.
Exposure assessment for case-control (CC) epidemiology studies based in Shanghai,
China: Summary of methods and results. T Armstronga , Y Zhou, C Zhang, S Bowes, Y Liang,
o Wong, F Hua, A Schnatter. a TWA8HR Occupational Hygiene Consulting, NJ, USA
As part of a suite of epidemiology studies of leukemia, lymphoma and aplastic anemia conducted in
Shanghai from 2001 to 2008, retrospective job and task focused exposure assessments (EA) of cases
and matched controls were completed for benzene and selected other hazards of concern. Trained
interviewers administered structured questionnaires (in Chinese) to study subjects recruited from 31
, hospitals. Initial classifications (exposed, iikeiy unexposed, or uncertain), done.by team members not
informed of case or control status, were made to focus subsequent investigations. Benzene EA
resources beyond questionnaires included industry-specific extracts from the Shanghai Municipal
Institute for Public Health Supervision database, Chinese literature on benzene exposures, on-site
workplace investigations, summaries of key regulatory and technology changes, and task simulations. A
Shanghai-based expert panel (EP) made preliminary exposure assignments, which were further refined
via logic and consistency checks with source data, resulting in range estimates 0 to 4 (none, <1, 1 to 10,
>10
to
100
and
>100
mg/m
3 )
for
benzene.
For
other
hazards,
sources
included
the
EP's
knowledge
of
relevant industries, and the Chinese and Western literature. A random 20% of the benzene EAs were
checked by two independent approaches using job titles and key task data extracted from
questionnaires. The CC database included over 21 ,000 work history events (WHE, or jobs). For study
subjects, 754 WHEunderwent further review for benzene exposure. The 754 WHE arose from diverse
industries and trades including: shoe manufacturing, rubber production, printing, painters and machine
repair. Nearly 40% of these WHs rated 2: category 2 benzene exposure, with rank counts and percents
of: 0 (150, 20%),1 (317,42%),2 (144,19%),3 (101,13%) and 4 (42, 6%). Review of initial differences
between study ratings and the 20% sample ratings suggested that the more detailed data (beyond
questionnaire extracts) available to the study team improved rating specificity. For other exposures, the
EA covered 19,157 WH events with 15,231 in the final CC database. The most prevalent general
category exposures included agricultural chemicals (2077), petroleum products (1339) and metals (908). The number, eras and diversity of VVH events presented a large, cha!lenging E6A, project, but the broad
information base assembled supported the extensive, multiple substance EA. Information about the
nature, extent and range of regulatory and technology changes in China, and the available Chinese
exposure literature, were key sources on chemical uses that enhanced the EA approach.
Do we agree? : Comparison of semi-quantitative exposure assessments by three independent approaches. TW Armstronga , JW Cherrie, RF Herrick, M Chen, SM Bowes, AR SchnaUer. a TWA8HR Occupational Hygiene Consulting, Branchburg NJ, USA (current affiliation)
As part of a review of exposure assessments (EA) for a population case-control study of acute myeloid leukemia and lymphoid neoplasm, we undertook a comparative evaluation of the study's semiquantitative retrospective EA for benzene. The overall study goal was to rate the benzene exposure for each subject's described tasks. The study approach (TWA's) drew on broad information available, including historical monitoring data, Chinese medical/exposure literature, on-site workplace investigations, reports on technology changes for key industrial sectors, prior discussions with and written review notes from the Chinese experts. A stratified random process was used to select a 20% sample from the study database. Two rateis (JWC, RFH) were provided partial data (from questionnaires only): start and end date for the work history, job title, type of industry, and a one to two sentence description of job duties. JWC's assessments were based on a structured subjective judgment approach developed for use in industry case-control studies, with results of then mapped to the study categories. RFH rated the exposures via the professional jUdgment, considering information on industry, job title and activities, materials used, processes, duration of work, and year. Following the ratings, TWA provided additional information from the study database that provided the rationale for study ratings that differed from the ratings of either JWC or RFH. Two of the raters (JWC, RFH) had somewhat less information than that drawn upon for the study EA. Due to these differences, a strict comparison of inter-rater comparability was not conducted. Weighted Kappas (generally in the range between 0.4 and 0.69) indicated reasonable agreement. Two categories represent no and very low 1 mg/m3) exposure, so comparisons were completed on "exposed" versus the two lowest categories as "unexposed". Those simple Kappas indicated moderate agreement. Another compprison showed scores were within plus/minus one category for approximately 85% of the subjects. JWC and RFH reviewed the additional information TWA provided and indicated this additional information would generally have altered theirratings in the direction of the study ratings. The three methods gave good agreement. The study ratings (TWA's) drew on additional information not available in the data extracts provided to RFH and JWC. Subsequent consideration of this additional information further improved the agreement of the raters. The comparison study suggests the additional information improved the EAs (TWA's) used in study epidemiologic analyses.
Page 1
:..X '." ~L.,.;.0............. ;~I.i '.s!iN'".'-:,.o.-'' XiIS''
1 of 1 DOCUMENT
Copyright 2005 Elsevier Ireland Ltd All Rights Reserved
Chemico-Biological Interactions
(2005) 153-154 ECHBOI C 55-64
May 30, 2005
SECTION: Pgs. 55-64 VoL 153-154 No. C ISSN: 0009-2797
LENGTH: 3871 words
TITLE: An overview ofpubiished benzene exposure data by industry in China, 1960-2003
AUTHORS: You-Xin Liang (a) yxliang@shmu.edu.cn; Otto Wong (b) (c) (d); Thomas Armstrong (e); Xi-Biao Ye (a); Li-Zhuang Miao (a); Yi-Mei Zhou (e); Qiang-En Wu (a); Hao-Jun Qian (a); Hua Fu (a)
(a) Fudan University School of Public Health, 138 Yixueyuan Road, Shanghai 200032, PR China
(b) Applied Health Sciences Inc., San Mateo, CA, USA
(c) Department of Epidemiology, Tulane University, New Orleans, LA, USA
(d) Department of Community Medicine, Chinese University of Hong Kong, Hong Kong, PR China
(e) ExxonMobil Biomedical Sciences Inc., NJ, USA
BODY:
ABSTRACT
This article presents an overview of occupational benzene exposures in China based on data published in Chinese medical journals. The data were derived from 384 reports of benzene poisoning or industrial hygiene surveys published in Chinese medical journals between 1960 and 2003. The following information was extracted whenever available: industry, occupation, task, date, benzene levels, sampling location, workplace descriptions and, for case reports, medical diagnosis. Each paper provided one or more sets of benzene data, each set representing a sampling location or job title with one to several measurements including, mainly, breathing zone area concentration measurements, and much less frequently personal monitoring. Two criteria based on data quality were applied to select suitable data for analyses. The selected exposure data were analyzed by industry and time period. Nine hundred five sets of benzene measurements from 72 industries were reported in the 384 papers selected for this review, and 621 sets (68.6%) presented average benzene concentrations, which covered 55 industries. The distribution of the reported average benzene exposures was skewed with a median of 51.5mg/m3. The average benzene concentrations were below 100mg/m3 for 406 (65%) of the 621 reported average concentrations. The medians of the reported averages in mg/m3 for the five industries with the
Page 2 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30,2005
highest exposures were: 124.8 for leather products, 98.7 for electronic devices, 75.4 for machinery, 50.4 for shoes, and 50.3 for office supplies and sports equipment manufacturing. These data describe the concentrations and changing patterns of occupational benzene exposure by industry and time period in China.
FULL TEXT
1 Introduction
Benzene is one of the most widely used industrial chemicals in China. A wide variety of industries and occupations particularly the shoe and suitcase industries in China use benzene or benzene-containing solvents and adhesives [1]. The Chinese occupational medical literature is replete with reports of benzene over-exposure and benzene poisoning [2,3]. In 1979-1981 the Chinese Academy of Preventive Medicine carried out a national occupational health survey of more than 500,000 workers in China who were identified as having been exposed to benzene [4]. The reported geometric mean concentration of benzene was 18.lmg/m3 and the 95% range at workplaces was 0.06-844.74mglm3 or 0.02-266ppm (lppm=3.l8mg/m3), with some workplaces (1.3%) having benzene concentrations in excess of 1000mg/m3. The data showed a skewed distribution with a second mode at approximately 200mg/m3 and more than 10% of the data were at or above this value [4]. The nature of the distribution makes the median ofthese data difficult to interpret. Measurements of area breathing zone occupational benzene exposure from the 1950s to the late 19808 taken at factories in Shanghai were reported in a recent article [5]. This database of benzene measurements is maintained by the Shanghai Municipal Institute of Public Health Supervision. The arithmetic mean ofbenzerte measurements for workplaces reported in the database was 132.7mg/m3 and the median was 2.8mg/m3.
In addition to ad hoc industrial hygiene surveys reported in the literature, there are incidents of acute poisoning and investigations of exposures associated with such events. For example, an investigation of33 cases of serious benzene poisoning and nine deaths in 2002, associated with small-scale suitcase manufacturing, reported exposures as high as 2040mg/m 3[6].1
Industries in China have been regulated with occupational exposure limits (OELs) for benzene since the 1950s. These limits have gone through revisions over the years as shown in Table 1, including a shift from the prior area concentration basis to personal exposure measurements in 2002. The development of OELs in China has been discussed in a number ofreccnt articles [1,7].
The current article presents an overview of occupational benzene exposures reported in Chinese medical journals between 1960 and 2003. The review includes 384 papers ofbenzene poisoning case investigations or industrial hygiene surveys, covering 72 industries in China classified according to the national industrial coding system [8]. Included in the overview is an analysis of benzene exposure data by industry and time period.
2 Material and methods
2.1 Information sources
Published literature was identified primarily through Internet searching ofthe China National Knowledge Infrastructure, which covers 1994-2003 and the Chinese Biomedical Literature Database, which covers 1978-1993. Manual searching was also carried out to supplement the online search, particularly for conference proceedings and articles published before 1978. Through this process, a total of384 benzene poisoning case reports or industrial hygiene surveys published in Chinese journals were identified.
The benzene exposure data was systematically extracted into a database. From each paper, the following information was extracted whenever available: industry, occupation, task, year, benzene levels (minimum, average and/or maximum), workplace descriptions and, for case reports, medical diagnosis. Each paper provided one or more sets of benzene measurements, with each set representing one or more measurements for a s~'11pling location or job title. Data for inclusion in the analyses were selected by applying standard acceptance criteria (as described below). Exposure
Page 3 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30, 2005
data were analyzed according to industry and time period. Table 2 provides an example of the data extracted for the database. The analyses do not distinguish between area concentration measurements and personal measurements because personal measurements were quite rare and the reports did not necessarily distinguish them, and the rare personal samples were unlikely to alter the general conclusions of the analyses in this report.
2.2 Selection criteria
Two criteria were applied to select the published data and information for inclusion in the analyses. The first criterion was used to select data for the analysis by industry type and the second criterion was used for selecting data for temporal analysis.
For the selection of data for the comparison of exposure level by industry type, the most important factors were the number of measurements in each set of measurements and the number of sets of measurements for the industry. A set of measurements consisted of: the sampling location or job title, the benzene measurements taken, and the year. Table 2 presents data from five published articles on benzene measurements. Article B in Table 2 provided three sets of measurements, covering three different jobs, while article E in Table 2 provided two sets of data, covering two different locations.
For the analyses in this report, we chose a weighted selection score (WSS) (described further below) of 18. This criterion considers the number of samples in a set and the number of measurement sets in a given industry. A score of
= + + + + + =18 was the minimum for an industry to be included in the analyses. For example, using the leather industry data in
Table 2: WSS 60 60 60 7 26 12 225Altematively, if only report Chad
been available for the leather industry, the WSS=7, which is below our required score of 18 and would thus not be included in the trend analyses.
A key component of the WS S criterion for data sets in our review was the quantitative strength of the data. Our "rule of thumb" for this hinged on a comlTIonly accepted sample size of six measurements in each set and six mea,surement sets in a given industry as a basis for a reliable estimate of an average concentration in typical industrial hygiene surveys [9]. It would have been optimal if each set of measurements had six samples as well to produce a score of 36 or above for calculating the median for each industry. However, this goal of six samples per set and six sets proved to be too stringent, so a compromise weighted score of "18" was chosen in order to include more data sets for the exposure level analysis according to industry type.
The criteria used to select information for the analysis of overall temporal trends of benzene exposure by industry required the published papers for the industry to include both average exposure concentration results and the year, and have at least six sets of measurements for each year.
2.3 Statistical analysis
N onparametric tests followed by the Kruslcal-Wallis H-test were applied to the statistical analysis by industry type. The Linear, Quadratic and Cubic Polynomial tests of one-way ANOVA contrasts were used for the analysis of overall temporai trends of benzene exposure from 1979 to 2001. P<O.05 was set to verify the statistical significance.
3 Results
3.1 General feature of occupational exposure to benzene
The articles included in the database were published between 1960 and 2003. Fig. 1 shows that few articles were published in the early 1960s and none between the mid 1960s and the late 1970s (the 10 years of the "Cultural Revolution" and its negative impact, which lasted for a few years afterwards). Starting in the 1980s, with the improvement of the national economy and heaith services, the frequency of inspections and air monitoring at workplaces greatly increased, resulting in a surge in the number of published papers.
4
An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30, 2005
.
Fig. 1. Number of published reports included in the analyses by year. Numbers in each bar represent the number of reports included in the analyses for that time period.
Fig. 2 shows the distribution of average benzene exposure levels included in the present analysis of a total number of621 sets data. It indieated that 264 data sets (42.4%) presented benzene concentration below 40mg/m3 including nine data sets (1.4%) reported having not-detected levels of benzene that were expressed as "0". There were 357 sets (57.6%) that exeeeded 40mglm3, the previous national benzene OEL adopted between 1962 and 2001 in China. Of those 621 sets, 142 sets (22.9%) presented eoneentrations between 40 and i 00mglm3, and 147 sets (23.7%) presented levels between 100 and 500mg/m3. There were 68 sets (11 %) of measurements that far exceeded 500mglm3, including 15 sets that reported benzene exposure concentrations above 3000mgim3. The highest levels were found for the following occupations: paint eoating/spraying and glue brushing (e.g., in shoes and suitcase industries). Some measurements were as high as several thousand mglm3. Levels of more than 10,000mg/m3 were reported for work in confined spaces without adequate ventilation, which was usually associated with acute benzene poisoning. As further examples, acute benzene poisoning cases were reported anlOng workers who painted the inner walls of oil storage tanks, worked in poorly ventilated basements, or in deep wells.
Fig. 2. Distribution of the average benzene exposure levels. Numbers in the bars denote the number of reports in the analyses in the given eoncentration range.
3.2 Comparison of benzene exposure by industry
Reports for 39 industries included both average benzene concentration data and the number of samples. Aceording
to the selection criteria, 27 (69.2%) industries (1972-2002) ofthe 39 met the required WSS of 18 and were included in
the analysis according to industry. The results, given in Table 3, show that the median benzene exposures in the nine
industries with the highest reported concentrations exceeded the previous OEL standard of 40mg/m3, and 59% (16 of
27) of the industries had median exposure levels above the new standards of either IOmg/m3 (permissible concentration-shOl1 term exposure limit; PC-STEL) or 6mgim3 (permissible concentration-time weighted average;
PC-TWA).
.
The previous OELs for chemical substances and dusts were expressed as maximum allowable eoneentrations that
were mainly based on stationary area breathing zone monitoring samples until 2001. The newly developed OELs in
terms of TWA and STEL have been adopted since 2002 while the area breathing zone monitoring samples at workplace
are still used beeause personal samplers havc not been commonly available.
the data remain comparable.
<.<
Page 5 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30,2005
Table 3 compares benzene measurements by industry, sorted by the median of the reported average exposures. Twenty-seven of the most related industries were ranked by median benzene concentrations in the table and further analyses were conducted to verify the statistical differences of exposure levels by nonparametric tests. Table 3 shows the five industries with the highest exposures (that met the criteria of six sets or more of measurements) were: leather products, electronic devices, machinery, shoes, and office suppliers and sports equipment manufacturing.
3.3 Historical trends of the benzene exposure data
According to the selection criteria described above, the reports of medians of the exposure levels for the 22 years between 1979 and 2001 were adequate for temporal trend analysis. The benzene exposure levels for the 22 years were overall significantly different (P<0.05). Fig. 3 shows the trend by year for the median exposure levels.
Fig. 3. Overall trend in median benzene exposure in Chinese industry, 1979-2001. (*) Indicates the number of
measurement sets in the database.
.
These trends were most likely influenced by several historical events. First, the national economy started growing in the late 1970s, which resulted in increased numbers of small-scale industries (SSIs) in rural areas. Second, the improvement of occupational health services after the mid 1990s brought about more stringent health inspections and workplace monitoring and resulted in more published data. Third, the new Occupational Disease Prevention and Control Act was adopted by the Standing Committee of the National People's Congress in 2001, which required the reporting of benzene over-exposures in industries, including in the SSIs in rural areas [10].
As shown by
4-7, average benzene exposure levels in several major industries showed a similar but variable
decline over the years. More significant declines were evident for the earlier periods. Most of these industries show
slightly increased exposure concentrations at the beginning of the 21 st century. The industries (Figs. 4-7) were chosen
for the analysis according to industry type mainly because of the amount of data available for them. This may in part be
due to more frequent investigations of these particular industries.
.....
4.. Change in average benzene exposure levels in leather manufacturing over time (1975-2003).
Page 6 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30,2005
Fig. 5. Change in average benzene exposure levels in leather shoes manufacturing over time (1982-2003).
-.
Fig. 6. Change in average benzene exposure levels in spray painting over time (1974-2003).
-.
Fig. 7. Change in average benzene exposure levels in furniture manufacturing over time (1994-2003). 4 Discussion and conclusions
This review article describes the Chinese data for occupational benzene exposure and its changing patterns according to industries and time period based on the data extracted from the published Chinese medical literatures between 1960s and 2003. The results provide important information for prioritizing the prevention strategy of benzene poisoning. The median values of the reported average concentrations and the ranges of the averages for the five highest industries (with six or more sets of measurements) are: leather products, 124.8 (3.7-267.8mgfm3); electronic devices, 98.7 (4.5-254.9mg/m 3); machinery, 75.4 (4.2-152.7mg/m3); shoes, 50.4 (1.3-1488.6mgfm3); and office supplies and sports equipment manufacturing, 50.3 (10.7-256.0mgfm3). These coincide with previously reported industries with higher prevalence of benzene-related hematopoietic diseases [4]. The percentage of industries with reported medians exceeding the prior OEL of 40mg/m3 was 33% (9 of 27). For 59% (16 of 27) of the industries, medians of the exposure levels were below the prior OEL (40mg/m3) but above the new standards of either 10mglm3 (PC-STEL) or 6mglm3 (PC-TWA).
With innovations in production technology, which included the use of toluene and xylene instead of pure benzene and improved working practices, and the improvement of occupational health services, overall average benzene exposure levels appeared to decline over the years. In particular, industries traditionally with high exposures such as leather products manufacturing, shoes, paint spraying and furniture industries showed declines. Relatively high levels (270.38mg/m3) were observed during the period between 1981 and 1985, but dropped to 73.85mgim3 in the second half
Page 7 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30, 2005
of 1980s. The exposure levels declined further to 48.42mg/m3 during the period between 1996 and 2000. However, the exposure levels fluctuated due to the influence of the national economic development and newly implemented legislations. For example, the average of the reported exposures rose to 121.25mg/m3 at the beginning of the 21st century, which might partially be due to the wider disclosure of over-exposures in small workshops commonly found in rural areas. Additionally, the current public awareness and the frequency of health inspection might bias the results to a certain extent. The dec1iningtendencies of occupational benzene exposures were also shown by a Job-Exposure Matrix investigation in Shanghai based on a database maintained in Shanghai Municipal Institute of Public Health Supervision (1953-1989) [4].
There are a number of limitations associated with the published information and the analyses currently presented. These include:
I) Different sampling and analytical methods were employed over the decades covered. Although this may introduce some bias, we believe that the differences are minor and will not significantly alter the findings of this review. 2) Our analysis did not distinguish between benzene poisoning case reports and industrial hygiene surveys. Benzene poisoning case reports refer to investigation of the Chinese regulation-defmed occupational benzene poisoning. Either acute or chronic benzene poisoning cases may thus represent high-end exposures. On the other hand, industrial hygiene surveys were commissioned for a variety of reasons, and are not necessarily targeted at facilities with benzene poisoning cases or high benzene exposures. The industrial hygiene survey reports L1.uS mayor may not better represent typical conditions. 3) Our selection criteria may have excluded some informative but smaller data sets. We believe the criteria gave us the more reliable data to use in our analysis, resulting in more robust summaries. 4) The original investigators who reported the data may have had a range of investigative needs and approaches that introduced indeterminate biases into their reported data. For example, what motivated or initiated the authors to write up benzene poisoning reports or industrial hygiene surveys and submit them for publication? 5) The data in the original reports are area samples that represent concentrations in the air at the location and time measured. However, these concentrations might not directly reflect worker exposures, particularly for full-shift exposures, because they did not account for various potential exposure zones. 6) The data for trend analyses in this report are averages given in the reports. These averages should give a good estimate of the typical concentrations. However, the averages do not give insights into the range and variability of the concentrations in the industries covered.
Acknowledgements
We are indebted to the Benzene Health Research Consortium for sponsoring the Shanghai Health Study, as well as Dr. Jerry Rice, Chair, Scientific Review Panel, Dr. Patrick Beatty, Chair, Technical Committee, Prof. Richard D. Irons, Dr. A. Robert Schnatter, and Gail Jorgensen for their continuing support and encouragement in conducting the investigation of benzene exposures. The authors are also grateful for colleagues and medical students working at the University of Colorado Health Sciences Center and Fudan University Medical Center Joint Clinical and Molecular Laboratory, who contributed to thditerature searching and database development.
TABLES
Table 1 Years 1956-1979
Standard 50mg/m3, Area breathing zone concentration
Reference [11,12]
Page 8 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30,2005
1979-2002 2002-Present
40mg/m3, Area breathing zone concentration
[13]
10mg/m3, Pel111issible concentration-short tel111 exposure limit; 6mg/m3, pel111issible [14]
concentration-time weighted average
Past and current benzene occupational exposure limits in China
Table 2 Article
A
No. of cases Industry and diagnosis
5 (atypical an- Leather manufac-
emia)
turing (shoes)
No. Year Task/area of description sets
1983
Min. Aver. Max. No. conc. conc. conc. of (mg/m3) (mg/m3) (mg/m3) sam
pIes
0 370 1530 NA
B 77 (chronic poisoning)
Underlay adhesive brushing
NA
Assembly fin- NA ishing
Leather manufacturing (shoes)
440.39
3 1985 Soles adhes- NA ive brushing
NA 60
48.43
NA 60
1128.39 NA
60
C
Leather manufac-
1989
turing (watch
bands)
D
17 (chronic Leather manufac-
NA
poisoning) turing (shoes)
45
122.5 300
7
4.3 NA 308 26
E Garment II NA
Leather manufacturing (suitcases)
126.44
2 2001 Gal111ent I NA 12
NA
191.71 NA
Examples of benzene exposure data extracted from the published Chinese medical literature for leather manufacturing
NA: not available.
NA
Table 3 Code Type of industry
252 Leather productsa 449 Electronic devices manufacturingG
No. of sets
18 6
No. of samples
1487
1930
Median Average (range)
124.8 124.1(3.7-267.8) 98.7 120.2(4.5-254.9)
Page 9 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30, 2005
42,43 243
Machinery manufacturingG Shoes manufacturing, leathera
291 Office supplies and sports equipmentQ 321 Spray painting 270 Furniture manufacturing 444 Msc. electronic parts manufacturing 472 Automobile manufacturing 314 Organic chemical industry 341 Rubber products manufacturing 998 Other industries 320 Paint manufacturing 31 Chemical industry 294 Printing industry 401 Metal-based products processing
6 70
6 29 8 7 6 19 15 10 37 18 8 10
6815 12197
106 1186 618 197 3478 650 182 6799 525 859 6416 77
75.4 75.6(4.2-152.7) 50.4 149.9(1.3-1488.
6) 50.3 79.4(10.7-256.0) 39.8 53.4(0-226.8) 39.3 36.6(2.0-72.0) 33.6 50.5(3.0-105.6) 32.8 56.8(0-196.1) 23.8 39.3(12.8-130.5) 22.9 114.6(0.1-633.6) 18.5 23.8(2.2-85.5) 13.2 23.9(1.0-127.5) 7.6 19.3(0-123.9) 6.5 7.2(0-23.6) 1.4 7.5(0-38.0)
296 Toy manufacturing
2
363 Coal products manufacturing
3
361 Crude oil processing
3
512 -7) were chosen for the analysis according to 3 industry type mainly because of the amount of data available for them. This may in part be due to more frequent investigations of these particular industries.Fig. 4. Change in average benzene exposure levels in leather manufacturing over time (1975-2003).Fig. 5. Change in average benzene exposure levels in leather shoes manufacturing over time (1982-2003).Fig. 6. Change in average benzene exposure levels in spray painting over time (1974-2003).Fig. 7. Change in average benzene exposure levels in furniture manufacturing over time (1994-2003).4 Discussion and conclusionsThis review article describes the Chinese data for occupational benzene exposure and its changing patterns according to industries and time period based on the data extracted from the published Chinese medical literatures between 1960& and 2003. The results provide important information for prioritizing the prevention strategy of benzene poisoning. The median values of the reported aver- . age concentrations and the ranges of the averages for the five highest industries (with six or
2531 23 992 22
132.9 96.0 62.6 57.2
132.9(1.5-264.3) 79.8(12.8-130.5) 54.4(7.4-93.2) 41.9(5.8-62.6)
Page 10 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May 30,2005 .,-
more sets of measurements) are: leather products, 124.8 (3.7-267.8mg/m3); electronic devices, 98.7 (4.5-254.9mg/m3); machinery, 75.4 (4.2-l52.7mg/m3); shoes, 50.4 (l.3-l488.6mg/m3); and office supplies and sports equipment manufacturing, 50.3 (l0.7-256.0mg/m3). These coincide with previously reported industries with higher prevalence of benzene-related hematopoietic diseases [4]. The percentage of industries with reported medians exceeding the prior OEL of 40mg/m3 was 33% (9 of27). For 59% (16 of 27) of the industries, medians of the exposure levels were below the prior OEL (40mg/m3) but above the new standards of either lOmg/m3 (PC-STEL) or 6mg/m3 (PC-TWA).With innovations in production technology, which included the use of toluene and xylene instead of pure benzene and improved working practices, and the improvement of occupational health services, overall average benzene exposure levels appeared to decline over the years. In particular, industries traditionally with high exposures such as leather products manufacturing, shoes, paint spraying and furniture industries showed declines. Relatively high levels (270.38mg/m3) were observed during the period between 1981 and 1985, but dropped to 73.85mg/m3 in the second half of 1980s. The exposure levels declined further to 48.42mg/m3 during the period between 1996 and 2000. However, the exposure levels fluctuated due to the influence of the national economic development and newly implemented legislations. For example, the average of the reported exposures rose to 121.25mg/m3 at the beginning of the 21 st century, which might partially be due to the wider disclosure of over-exposures in small workshops commonly found in rural areas. Additionally, the current public awareness and the frequency of health inspection might bias the results to a certain extent. The declining tendencies of occupational benzene exposures were also shown by a Job~Exposure Matrix investigation in Shanghai based on a database maintained in Shanghai Municipal Institute of Public Health Supervision (1953-1989) [4].There are a number oflimitations associated with the published information and the
Page 11 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
May}O, 2005
analyses currently presented. These include:l) Different sampling and analytical methods were employed over the decades covered. Although this may introduce some bias, we believe that the differences are minor and will not significantly alter the findings of this review.2) Our analysis did not distinguish between benzene poisoning case reports and industrial hygiene surveys. Benzene poisoning case reports refer to investigation of the Chinese regulation-defined occupational benzene poisoning. Either acute or chronic benzene poisoning cases may thus represent highend exposures. On the other hand, industrial hygiene surveys were commissioned for a variety of reasons, and are not necessarily targeted at facilities with benzene poisoning cases or high benzene exposures. The industrial hygiene survey reports thus mayor may not better represent typical conditions.3) Our selection criteria may have excluded some informative but smaller data sets. We believe the criteria gave us the more reliable data to use in our analysis, resulting in more robust summariesA) The original investigators who reported the data may have had a range of investigative needs and approaches that introduced indeterminate biases into their reported data. For example, what motivated or initiated the authors to write up benzene poisoning reports or industrial hygiene surveys and submit them for publication?5) The data in the original reports are area samples that represent concentrations in the air at the location and time measured. However, these concentrations might not directly reflect worker exposures, particularly for full-shift exposures, because they did not account for various potential exposure zones.6) The data for trend analyses in this report are averages given in the reports. These averages should give a good estimate of the typical concentrations. However, the averages do not give insights into the range and variability of the concentrations in the industries covered.AclmowledgementsWe are indebted to the Benzene Health Research Consortium for sponsoring the Shanghai Health Study, as well as Dr. Jerry Rice, Chair, Scientific Review Panel, Dr. Patrick Beatty, Chair, Technical Committee, Prof. Richard D.
Page 12 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
o. May 30, 2005
Irons, Dr. A. Robert Schnatter, and Gail Jorgensen for their continuing support and encouragement in conducting the investigation of benzene exposures. The authors are also grateful for colleagues and medical students working at the University of Colorado Health Sciences Center and Fudan University Medical Center Joint Clinical and Molecular Laboratory, who contributed to the literature searching and database development.TABLESTable 1Y earsStandardReference 1956-19795Omg/m3 , Area breathing zone concentration[11,12] 1979-200240mg/m3, Area breathing zone concentration[ 13]2002-Present! Omg/m3, Permissible concentration-short term exposure limit; 6mg/m3, permissible concentration-time weighted average[14]Past and current benzene occupational exposure limits in ChinaTable 2Artic1eNo. of cases and diagnosisIndustryNo. of setsYearTaskiarea descriptionMin. conc. (mg/m3)Aver. conc. (mg/m3)Max. conc. (mg/m3)No. ofsamplesA5 (atypical anemia)Leather manufacturing (shoes)1198303701530NAB77 (chronic poisoning)Leather manufacturing (shoes)31985S01es adhesive brushingNAl128.39NA60Underlay adhesive brushingNA440.39NA60Assembly finishingNA48.43NA60CLeather manufacturing (watch bands)1198945122.53007D17 (chronic poisoning)Leather manufacturing (shoes) 1NA4.3NA30826ELeather manufacturing (suitcases)22001 Gannent INA191.71NANAGarment IINA126.44NA12Examples of benzene exposure data extracted from the published Chinese medical literature for leather manufacturingNA: not available.Table 3CodeType of industryNo. of setsNo. of samplesMedianAverage (range)252Leather productsa181487124.8124.1 (3.7-267.8)449Ele ctronic devices manufacturinga6193098. 7120.2(4S254.9)42, 43Machinery manufacturinga6681575.;475 .6(4.2-152.7)243Shoes manufacturing, leathera701219750.4149.9(1.3-1488.6)2910ff ice supplies and sports equipmenta61 0650.379.4(10.7-256.0)321 Spray
Page 13 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
~. May 30, 2005
painting29 I 18639.853.4(0-226.8)270Fumiture manufacturing861839.336.6(2.0-72.0)444Msc. electronic parts manufacturing719733 .650.5(3 .0-1 05 .6)472Automobile manufacturing6347832.856.8(0-196.1)3140rganic chemical industry1965023 .839.3(12.8-130.5)341 Rubber products manufacturingI518222.9114.6(0.1-633 .6)9980ther industries 10679918.523 .8(2.2-85.5)320Paint manufactur-
13.223.9(1.0-127.5)31 Chemical industryI88597.619.3(0-123.9)294Printing industry864166.57.2(0-23.6)401 Metal-based products processingl0771.47.5(0-38.0)296Toy manufacturing22531132.9132.9(1.5-264.3)363Coal products manufacturing32396.079.8(12.8-130.5)361 Crude oil processing399262.654.4(7.4-93.2)512Petroleum & geological prospecting
238
Other textile industries/printing & dyeing
1
520 Civil engineering & construction
3
374 Pottery & porcelain products manufacturing 3
450 Electronic circuit manufacturing
3
342 Plastic products manufacturing
2
499 Other precision instruments manufacturing 2
407 Household metal hardware manufacturing
178 137 26 26 1216 44 1139
26.2 26.2 20.3 122.2(1.2-345.2) 20.2 22.4(7.1-40.0) 20.2 22.4(7.1-40.0) 15.2 14.3 14.3(8.7-19.9) 2.3 2.3
Comparison ofthe average benzene concentrations (mg/m3) by industry
aDenotes the top five industries with more than six measurement sets in an individual industry. Industries following the blank space (after 401, metal-based processing) are those for which fewer than six data sets were available.
FOOTNOTES 1. No systematic monitoring data with the report were available as the governmental occupational health inspection has not always effectively accessed the informal work sectors in rural areas.
REFERENCES:
[I], O. Wong; Regulation of occupational exposures in China; Regul. Toxico!. Phannacol.; Vol. 38, (2003), pp. 109-111.
[2]. O. Wong; Letter from Shanghai; Occup. Environ. Med.; Vol. 60, (2003), p. 233.
[3]. O. Wong; Investigations of benzene exposure, benzene poisoning and malignancies in China; Regut Toxicol. Pharmacol.; Vol. 35, (2001), pp. 126-135.
Page 14 An overview of published benzene exposure data by industry in China, 1960-2003 Chemico-Biological Interactions
.~ May 30, 2005
[4]. S.Y. Yin, Q. Li, Y. Liu, F. Tian, C. Du, C. Jin; Occupational exposure to benzene in China; Br. J. Ind. Med.; Vol. 44, (1987), pp. 192-195.
[5]. S.R. Zhu, W. Lu, S.Z. Xue, 1.S. Y.L. Jiang; Job-exposure matrix of Shanghai: the ,analysis of the intensity of occupational benzene exposure during 1953-1989; l Environ. Occup. Med.; VoL 21, (2004), pp. 52-54(in Chinese).
[6]. C,x. Zhao, R. Luo, lG. Li, H.B. Zhou, W. Zhao; Analysis ofthe benzene poisoning episode in Gaobeidian suitcase industry in 2002; Chin. Occup. Med.; Vol. 30, (2003), pp. 32-34(in Chinese).
[7]. Y.X. Liang, Z. Su, W.A Wu, B.Q. Lu, W.Z. Fu, L. Yang, lY. Gu; New trends in the development of occupational exposure limits for airborne chemicals in China; Regul. ToxicoL Pharmacol.; VoL 38, (2003), pp. 112-123.
[8]. State Bureau of Statistics, State Bureau ofNational Standards, Office of State Council of Census, Industrial
Classification and Coding System of National
(official document for the 3rd National Census) (in Chinese),
1982.
[9]. J.R. Mulhausen, J. Damiano Editors; A Strategy for Assessing and Managing Occupational Exposure; AIHA Prss, Fairfax, VA (1998),.
[10]. Standing Committee of National People's Lo:n2:ress. Occupational Disease Prevention and Control Act, P.R. China (official document, in Chinese), 200].
[In State Commission of Economy Construction and Ministry of Health, P.R. China, Provisional Hygienic Standards for the Design ofIndustrial Premises (Standard-101-56) (official document, in Chinese), 1956.
[12]. State Commission of Economy Planning and Ministry of Health, P.R. China, Hygienic Standards for the Design of Industrial Premises (GBJ) 1-62 (official document, in Chinese), 1962.
[13]. Ministry of Health, P.R. China, Hygienic Standards for the Design of Industrial Premises (TJ36-79) (Official document,in Chinese, 1979).
[14]. Ministry of Health, P.R. China, Occupational 2-2002) (official document, in Chinese), 2002.
Limits for Hazardous Agents in the Workplace (GBZ
LOAD-DATE: September 19,2007