Document 93QN78vJ5zgrGnoa0QNeRqg35

NEOPLASIA In utero origin of t(8;21) AML1-ETO translocations in childhood acute myeloid leukemia Joseph L. Wiemels, Zhijian Xiao, Patricia A. Buffler, Ana T. Maia, Xiaomei Ma, Brian M. Dicks, Martyn T. Smith, Luoping Zhang, James Feusner, John Wiencke, Kathy Pritchard-Jones, Helena Kempski, and Mel Greaves Recent reports have established the prenatal origin of leukemia translocations and resultant fusion genes in some patients, including MLL-AF4 translocations in infants and TEL-AML1 translocations in children. We now report evidence for the prenatal origin of a translocation in childhood acute myeloid leukemia (AML). The t(8;21) AML1ETO translocations were sequenced at the genomic level in 10 diagnostic leukemia Introduction samples from children with available neonatal Guthrie blood spots. Clonotypic genomic AML1-ETO sequences were detected in the Guthrie spots for 5 individuals, providing unambiguous evidence of prenatal origin in these cases. Two of these patients were older than 10 years of age at diagnosis, indicative of a protracted postnatal latency. Three of the patients were assessed for the persistence of genomic fusion sequences in complete clinical remission samples and were found to be positive. These data indicate that t(8;21) in childhood AML can arise in utero, possibly as an initiating event in childhood AML, and may establish a longlived or stable parental clone that requires additional secondary genetic alterations to cause leukemia. (Blood. 2002;99:3801-3805) 2002 by The American Society of Hematology The etiology of childhood leukemia is currently under scrutiny by means of large-scale epidemiology studies. Despite this intense investigation, a basic understanding of the timing of the origin of the crucial molecular abnormalities, or the "natural history" of leukemic clones, is incomplete. The recognition of crucial temporal and developmental windows for the formation of leukemogenic genetic alterations will help to focus epidemiologic analysis as well as to prompt preventive strategies. Recent studies using twins with concordant leukemia suggest that a hallmark genetic event in these acute leukemias, ie, chromosomal translocation, can have a prenatal origin.1-5 More explicit evidence is provided by the finding of clonotypic chromosomal fusion sequences in archived neonatal (Guthrie) heel-prick spots matched to children who later contracted leukemia.6-8 Additional indirect support for prenatal origin of leukemia clones is derived from the demonstration of the presence of clonotypic rearrangements at the IGH and TCR loci in Guthrie spots.9,10 These studies have concentrated on a limited subset of leukemias primarily of lymphoid phenotype, leaving open the question of whether prenatal origin of childhood leukemia is a possible or common occurrence in other subgroups. Childhood acute myeloid leukemia (AML) composes about 20% of childhood leukemias overall, and represents a group of diseases with a variety of molecular subtypes. After a peak incidence of leukemias in infants with translocations involving the MLL gene, children with AML exhibit the same range of molecular abnormalities as adults--characteristic translocations, deletions, and aneuploidies. The most frequent translocation in both child- hood (1 to 20 years of age) and adult (older than 20 years) AML is the t(8;21) AML1-ETO fusion, resulting in a fusion protein that disrupts the normal function of the transcription factors AML1 and ETO.11 Rather than exhibiting an age-associated peak incidence like the MLL translocations (younger than 1 year) and TEL-AML1 translocations (2 to 5 years), the incidence of leukemia with t(8;21) increases slowly during childhood and is constant throughout life.12 Leukemias with t(8;21) translocations also occasionally present following chemotherapy for other cancers or certain occupational exposures (reviewed in Xiao et al13). These facts are compatible with the interpretation of t(8;21) as a postnatal event in temporal proximity to leukemia diagnosis. Alternatively, t(8;21) may occur commonly during early life (during, say, fetal hematopoiesis), yielding long-lived clones that may or may not progress to overt leukemia later in life depending upon the acquisition of appropriate secondary genetic events. To begin to address these questions, we describe a molecular analysis of a series of childhood AML patients with matched Guthrie cards and follow-up remission material. Patients, materials, and methods Patients and patient materials Patients and matched Guthrie cards were from California (n 7) and the United Kingdom (n 3). California patients were enrolled in the Northern California Childhood Epidemiology Study or the Children's Oncology From the Laboratory for Molecular Epidemiology, Department of Epidemiology and Biostatistics, University of California San Francisco; Leukaemia Research Fund Centre, Institute of Cancer Research, and the Leukaemia Research Fund Centre for Childhood Leukaemia, Molecular Haematology and Cancer Biology Unit, Institute of Child Health, London, United Kingdom; School of Public Health, University of California Berkeley; Department of Hematology/Oncology, Children's Hospital Oakland, CA; Children's Cancer Unit, Royal Marsden Hospital, Sutton, Surrey, United Kingdom. Submitted November 13, 2001; accepted January 14, 2002. Supported by National Institutes of Health grants CA89032 (J.L.W.), ES09137 (P.A.B.), and ES04705 (M.T.S.); a Leukaemia Research Fund Specialist Programme Grant (M.G.); and Portuguese Foundation for Science and Technology grant PRAXIS XXI/BD/19575/99 (A.T.M.). Reprints: Joseph L. Wiemels, Laboratory for Molecular Epidemiology, Dept of Epidemiology and Biostatistics, University of California San Francisco, 500 Parnassus Ave MU-420W, San Francisco, CA 94143-0560; e-mail: jwiemels@epi.ucsf.edu. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked ``advertisement'' in accordance with 18 U.S.C. section 1734. 2002 by The American Society of Hematology BLOOD, 15 MAY 2002 VOLUME 99, NUMBER 10 3801 3802 WIEMELS et al BLOOD, 15 MAY 2002 VOLUME 99, NUMBER 10 Group AML cell bank. Patients in the United Kingdom were enrolled in the United Kingdom Medical Research Council AML 10 trial. High-molecular weight DNA was isolated from patient bone marrow by means of conventional sodium dodecyl sulfate (SDS)/proteinase K methods. Neonatal blood spots, or Guthrie cards, were obtained from a central repository maintained by the Genetic Diseases Branch of the California State Department of Health, for California patients, and from different regional centers for United Kingdom patients. For 3 patients, small portions of leftover bone marrow aspirates obtained for diagnostic purposes following treatment were obtained from the hospitals of treatment. Research ethics committees at participating institutions reviewed and approved all procedures. Breakpoint sequencing Patient breakpoints were sequenced by means of long-distance inverse polymerase chain reaction (LDI-PCR) and conventional long distance PCR (LD-PCR), as previously described.13 We tried LD-PCR reactions first when DNA was plentiful (exceeding 10 g), while we tried LDI-PCR first when DNA was limiting. When one approach failed at amplifying a translocation, we used the other approach. Guthrie card screening For nested reactions, we designed specific PCR primers spanning each patient's fusion sequence (Table 1). In most cases, primer design called for a first-round PCR with 60C annealing temperature followed by a second round with 66C annealing. Sensitivity of PCR reactions was determined by means of serial dilutions of diagnostic DNA. PCR screening of Guthrie cards was performed with Ampdirect buffers (Nacalai Tesque, Osaka, Japan, or Rockland Immunochemicals, Gilbertsville, PA) exactly as previously described.7 Briefly, a first-round amplification in Ampdirect was followed with a subsequent nested amplification with the use of 1 L the primary reaction as template and conventional Taq polymerase and buffers. Ampdirect buffers allow PCR amplification directly from blood or, in this case, blood-soaked filter papers, by abrogating the effects of PCR inhibitors in blood. One-eighth segments (United Kingdom cards, 1 cm diameter) or one-sixteenth segments (California cards, 1.5 cm diameter) of cards were placed in single tubes. Serial dilutions of diagnostic DNA were amplified in tandem in separate PCR tubes to ensure the sensitivity of each reaction. Preparation of PCR reactions, the cutting of Guthrie cards, and the dilution and allocating of diagnostic DNA were all done in separate rooms. DNA from archived slides (in the case of available remission material for 3 patients) was purified by conventional SDS/proteinase K methods after scraping the slide contents into a microcentrifuge tube. The DNA was quantified by means of fluorimetry and used directly for PCR in standard buffers with the same primers and assay used for Guthrie analysis, except for the use of conventional PCR buffers for both rounds of PCR. Prior to translocation-specific PCR, the DNA was subjected to PCR of control genes (NQO1 and NRAS) as previously described.5 Results Matched Guthrie card samples were available for 12 patients. We attempted amplification of clonotypic genomic AML1-ETO fusion in all 12 patient samples and were successful in 10 of them. For the 2 remaining samples, diagnostic karyotypes indicated t(8;21); however, AML1-ETO fusion messenger RNA (mRNA) was not detectable by reverse transcriptase (RT)PCR, suggesting that the patients might have had a different fusion. The sequences of 9 of these breakpoints are presented elsewhere.13 The one remaining sample (patient no. 9) was a fusion between base 21788663 on Genbank entry NT_011512.4 (AML1 intron 5) and base 242182 on Genbank entry NT_029344.1 (ETO intron 1B) with a single nontemplate "C" at the point of fusion. Shortdistance PCR primer sets for all fusions were designed for the genomic fusion of each patient (Table 1) and were checked for sensitivity and specificity by means of serial dilutions of diagnostic patient material and control DNAs (data not shown). PCR screening of Guthrie cards was performed without prior extraction of DNA. All of the Guthrie material (cut segments of individual blood spots) was placed into the PCR reaction to maximize the opportunity to amplify a rare sequence. Isolation of DNA from a Guthrie spot is variable and depends on age of the card and storage conditions, but cards at least 20 years old have been shown to have equivalent capacity to support PCR amplification in Table 1. Polymerase chain reaction primers used for backtracking genomic AML1-ETO translocations in 10 patients Patient PCR round AML1 primers (5-3) ETO primers (5-3) 1 1 CTGCCATTCCGCTGACTAAG AGATTCTCACCTAAAAGTCTGACT 2 CTGCCATTCCGCTGACTAAG GCAGCGGGGCCTAGCTGAAT 2* 1 GTCTTCACAAACCCACCGCAAGTCG CCTCCACATCTAGAAAGCAGGTCTACAGCAC 2 CCCGAGAACCTCGAAGTAAGTGCAT CCTCCACATCTAGAAAGCAGGTCTACAGCAC 3 1 GGGAGCAGAAGTGAGATGGT CTAAATACTGTACCCAAGAAGGG 2 GGTTGAGGCAGAATGCAAAAGTTCAAG GGCTGCTTTATCCAGCGAACCC 4 1 TACCGTACATTATGGCTATATTATCA AATGCCGAATAATTTATTCACCACCACC 2 GCCAGTGACATTTAGTTGGATGTGAAAT CCCATCCTGTTCAAGGTTAACCC 5* 1 AGGGCCTAATCTTCACTCAGCTAC AACGCGCATTGATGAATGGTC 2 CTTGGTTGAGATCATGTCATATGAG AACGCGCATTGATGAATGGTC 6 1 GGAAGCTCACCAGATAGGCT GTACTATACTTATGTTAGAAAGAAAACA 2 AGCTACCTCTGGGCTCCAGTG CACAGTGGGAAACCCAACCTTTCAT 7 1 ATAATAAAATTCCAAGCAAGTACTTTCA AAAGCTTAAAGCTACACATGGTC 2 AATTTAGGACCTTTTTCAACTCTGCTTAAG CCACAATTCTCCCCATTCAGTTTTCAG 8* 1 GAAGCGGCAGTAACCCAGGTG CCAGGTTCAATGGACTCTTCCC 2 GTGCAGCTCTGAGTGAGCTGG GGCTATTTTCTTCTCAGCAGTCCAG 9 1 CTTAGCTTAACGATATGAGAAGAAAT CTAGCCTTCACCTATGACTTATG 2 GTTACGTAGCACTGGACAATATATAAGCA CTCAGGTCACTTTGATTTTTGCATCTCC 10 1 AACCACTGAAATTTGAGTCTTGAG AGGATATGGAGCCAAGATCTCT 2 CTGGCCCTGCTAGCTCAGTCAA CCAAATTGTATAATAAAAATAGACAATCAATAACATG Product size 126 102 165 91 541 503 132 69 170 125 195 141 447 320 249 136 238 147 381 215 PCR indicates polymerase chain reaction. *Patients born and diagnosed in the United Kingdom. The remainder were born and diagnosed in California. Breakpoints for most patients were previously reported in Xiao et al.13 Patient 1 listed in this Table corresponds to patient no. 13 in Xiao, et al. Patient 2 is previous patient no. 1; patient 3, previous no. 15; patient 4, previous no. 9; patient 5, previous no. 6; patient 6, previous no. 19; patient 7, previous no. 14. Patients no. 8 and 10 are the same in both studies. BLOOD, 15 MAY 2002 VOLUME 99, NUMBER 10 BACKTRACKING AML1-ETO TRANSLOCATIONS 3803 relative equal measure when performed with Ampdirect (Wiemels et al7 and data not shown). At least 4 segments of a Guthrie card blood spot were available for each patient (Table 2). Of the 10 patients studied, 5 supported amplification of specific clonotypic AML1-ETO sequence on at least one segment (Figure 1 and Table 1). PCR products were sequenced with the use of one internal primer. In all 5 cases, the sequence of the Guthrie cardamplified band matched the sequence originally determined from the diagnostic sample. Therefore, in at least 5 of 10 AML cases studied, the clonotypic, genomic fusion sequence and presumptive leukemic or preleukemic cells were present at birth, several years prior to a diagnosis of leukemia. Despite the fact that the 2 patients youngest at the time of diagnosis had positive evidence of genomic t(8;21) rearrangement at birth, there was otherwise no clear relationship to age. In fact, the 2 oldest patients (nos. 9 and 10) also demonstrated prenatal origin, which is remarkable in that both of these patients were older than age 10 years at the time of diagnosis. One additional patient (no. 5), aged 61/4 years, was positive. Additional diagnostic bone marrow smears were available for 3 patients enrolled in our study following chemotherapy-induced leukemia remission. These smears were obtained during routine follow-up of patients to monitor treatment success. All 3 patients had cytologically normal bone marrow, ie, lacking the obvious presence of leukemic blasts. As demonstrated in Figure 2, however, all patients had demonstrable clonotypic genomic AML1-ETO fusion sequence in nonquantitative PCR assays in their remission samples. These samples were taken when the patients were either on therapy, had just finished therapy, or had been off all therapy for no longer than 6 months (Figure 2). Longer-term remission samples were not available. Two patients (nos. 3 and 4) continue to be in first remission, while one (no. 2) is now deceased as a result of leukemia relapse. This preliminary assay does not have any prognostic relevance for these patients. Discussion Figure 1. PCR analysis of clonotypic genomic AML1-ETO fusions in neonatal Guthrie cards of leukemic patients. Two rounds of PCR (70 total cycles) were performed as described in "Patients, materials, and methods," and the results are shown only from the secondary round. Partial results are shown; in most cases a second PCR run was performed. Five "positive" PCR patients are shown, as well as one negative. Lane markers: M indicates marker. Lanes 1-6 show 1:10 dilutions of patient DNA, with lane 1 being 100 ng/L and lane 6, 1 pg/L DNA. Patient DNAs have varying percentages of leukemic DNA, as some patient samples are from blood rather than bone marrow. C indicates control Guthrie card without patient DNA; P, Guthrie card segment from the patient; P, patient Guthrie card segment that was sequenced and determined to be the same sequence as the diagnostic DNA sample of that patient; B, no DNA sample (blank). our assay preclude the detection of a clone harbored in a bone marrow compartment and not circulating in the bloodstream at a frequency of at least 1 cell per 30 000 (the approximate number of cells in one 1-cm diameter blood spot6,7), and we have screened, at maximum, the equivalent of 1.5 such blood spots (12 segments) per patient. We therefore cannot definitively say whether the prenatal With this report, we present the first direct evidence for a prenatal origin of t(8;21) AML1-ETO in childhood AML. The assay uses genomic fusion gene sequence, rather than the mRNA, and is therefore specific for the leukemic clone. Of 10 patients assessed, 5 had positive Guthrie cards. This analysis does not, however, rule out a prenatal origin for any or all of the remaining 5 negative Guthries, as negative results are not definitive.7 The limitations of Table 2. Patient age at diagnosis and summary of backtracking AML1-ETO genomic fusions in childhood acute myeloid leukemia Study Age at diagnosis, Guthrie segments Guthrie segments Positive no. y, mo tested positive or negative* 1 3, 6 2 3, 11 3 4, 11 4 5, 2 5 6, 3 6 7, 9 7 8, 7 8 10, 0 9 10, 1 10 12, 2 12 4 12 12 4 12 12 10 12 12 2 2 0 0 1 0 0 0 5 1 *A plus sign indicates the presence of clonotypic AML1-ETO in the Guthrie card; a minus sign indicates the lack of demonstrable clonotypic translocation sequence, which is indeterminate for prenatal origin. Figure 2. Analysis of patient remission DNA for clonotypic AML1-ETO translocation persistence after treatment. First, DNA extracted from bone marrow samples was tested for integrity with the use of control gene PCRs (NQO1 and NRAS primers, data not shown). With the same primer sets that were used for screening Guthrie cards, bone marrow samples obtained from treated patients were tested for translocation sequences. All patient samples tested after treatment proved to be positive for clonotypic fusion sequence after 2 rounds of PCR (lanes R). Key to lanes: M indicates marker; D, diagnostic patientspecific DNA; K, Kasumi cell line DNA; H, HL-60 cell line DNA; C, human DNA from a nonpatient control; R, bone marrow sample for patient no. 2 obtained while the patient was on treatment at 5 months after diagnosis; R1, R2, and R3, bone marrow samples from patient no. 3 obtained immediately following induction treatment (2 months after diagnosis), at the end of consolidation (3 months after diagnosis), and 4 months off all therapy (8 months after diagnosis), respectively; RA and RB, DNA from bone marrow from patient no. 4 obtained when the patient was just off all therapy (11 months after diagnosis) and 6 months off all therapy (16 months after diagnosis), respectively. 3804 WIEMELS et al BLOOD, 15 MAY 2002 VOLUME 99, NUMBER 10 origin of this leukemia subtype in childhood is typical or usual, although we do conclude that it is possible and common. Our current report adds one more translocation type, and the first such type for childhood AML in patients older than 2 years, to those previously discovered to have prenatal origin: the MLL and TEL-AML1 translocations. Two of our positive AML1-ETO patients were older than 10 years of age at diagnosis. These are, to date, the oldest patients to receive an AML diagnosis and to have an AML that was found to have a prenatal origin by means of this assay, although studies with identical twins have also indicated that postnatal latency following initiation in utero can be very protracted.3,5 Taken together, these reports clearly implicate the fetal period as a distinctly susceptible period for chromosomal translocation, perhaps the usual period for such events among pediatric leukemias. It is noteworthy that other childhood cancers, particularly the sarcomas, are also commonly associated with translocations.14 The occasional congenital presentation of such tumors also argues for a prenatal origin and potentially related mechanisms of formation. A further commonality among the 3 prenatally occurring translocation types (MLL, TEL-AML1, and AML1-ETO) is the structure of the fusion breakpoints. This includes scattered breakpoint distribution with weak clustering, and the evidence of constitutive repair processes for the fusion event.13,15,16 Conspicuously lacking among all 3 types is evidence of formation via a V(D)J recombinase mechanism, a mechanism well-established for the formation of lymphoma translocations17,18 and occasionally hypothesized to be implicated in childhood translocations.19,20 The combined evidence suggests, however, that pediatric translocations that occur in utero form by means of as-yet ill-defined breakage followed by error-prone nonhomologous end joining of broken chromosome ends. These processes could be related to the extensive cell proliferation, oxidative stress, and apoptosis during prenatal hematopoiesis. For infant leukemias with MLL fusions, there is recent epidemiological evidence implicating transplacental chemical exposures.21 Clinical and biologic analysis of t(8;21) leukemia suggests that the translocation may persist in a patient's bone marrow, with evidence of AML1-ETO RT-PCR cells in patients in long-term remission, up to 12.5 years after treatment.22-24 Quantitative assessment by real-time (Taqman) PCR suggests that persistent levels above a threshold may herald relapse but that patients with lower levels of positive cells remain disease free.25-27 Our current result confirms this at the level of genomic sequence, providing direct evidence for the persistence of the same leukemic clone. The longevity of the clone after treatment is paradoxical given that this leukemia subtype has relatively good prognosis in both adults and children, with a cure (greater than 5-year clinical remission) possible in about half of patients.28,29 Persistent AML1-ETO cells might reflect some control mechanism, immunological or otherwise, restraining the leukemic cells. Alternatively, the persistent cells could be preleukemic cells with AML1-ETO but lack the additional secondary events. From the age of our patients with positive Guthrie spots, we can conclude that such cells both exist and persist for up to 10 years or more. The AML1-ETO persistence phenomenon was studied in detail by Miyamoto and colleagues,30 who sorted and cultured bone marrow cells from patients in remission. AML1-ETO transcripts were present in various stem and myeloid progenitor cell compartments, as well as in B cells and monocytes but not in T cells; the authors interpreted this as reflecting the persistence of a preleukemic multipotential stem cell. An animal model of AML1-ETO leukemia supports a multistep scenario. Mice with an AML1-ETO inserted into one AML1 locus do not develop myeloid leukemia, but will do so at a much higher rate than controls following treatment with the alkylating agent and mutagen ethyl nitrosourea, which presumably induces the necessary secondary event(s).31,32 In these respects, childhood AML parallels ALL with TEL-AML1. In the latter cases, twin concordance data indicate the need for secondary postnatal events4,8 coupled with postnatal persistence of the fetal preleukemic clone for up to 14 years.5 Persistent preleukemic clones with TEL-AML1 may, in some cases, also give rise to late relapses of disease following prolonged remission.33 The descriptive epidemiology of t(8;21) leukemia shows a relatively constant age-specific incidence.12 This raises the question of whether translocation-positive preleukemic stem cells formed in utero may persist to adulthood, providing a lifetime reservoir of "initiated" cells that may progress at any time to AML given the appropriate secondary genetic alterations. If correct, then a difference between childhood and adult leukemia might be in the etiologic exposures that induce progression of the t(8;21)-initiated clone to frank leukemia. Future studies investigating such a hypothesis should examine clonotypic AML1-ETO sequences in Guthrie cards of adults with de novo AML. The presence of AML1-ETO in therapy-related adult AML indicates that this fusion is possibly induced in stem cells of adults; however, future studies will have to assess whether or not the fusion gene was pre-existent to the patient's exposure to chemotherapy for the primary cancer. Acknowledgments We thank physicians and hospitals in California and the United Kingdom who contributed diagnostic material to this study; the California Department of Health Services for access to Guthrie cards, including the efforts of Dr Peggy Reynolds, Michael Layefsky, and Dr Fred Lorey; and the Children's Oncology Group and efforts of Dr Anita Khayat and Stacey Dozono for access to patient diagnostic material. We also acknowledge Sandra Hing and John Swansbury for cytogenetic and molecular diagnostic data and samples for United Kingdom patients and Dr Wyn Griffiths for retrieval of Guthrie cards. References 1. Ford AM, Ridge SA, Cabrera ME, et al. In utero rearrangements in the trithorax-related oncogene in infant leukaemias. Nature. 1993;363:358-360. 2. Gill Super HJ, Rothberg PG, Kobayashi H, Freeman AI, Diaz MO, Rowley JD. Clonal, nonconstitutional rearrangements of the MLL gene in infant twins with acute lymphoblastic leukemia: in utero chromosome rearrangement of 11q23. Blood. 1994;83:641-644. 3. Ford AM, Pombo-de-Oliveira MS, McCarthy KP, et al. Monoclonal origin of concordant T-cell ma- lignancy in identical twins. Blood. 1997;89:281285. 4. Ford AM, Bennett CA, Price CM, Bruin MC, Van Wering ER, Greaves M. Fetal origins of the TELAML1 fusion gene in identical twins with leukemia. Proc Natl Acad Sci U S A. 1998;95:45844588. 5. Wiemels JL, Ford AM, Van Wering ER, Postma A, Greaves M. Protracted and variable latency of acute lymphoblastic leukemia after TEL-AML1 gene fusion in utero. Blood. 1999;94:1057-1062. 6. Gale KB, Ford AM, Repp R, et al. Backtracking leukemia to birth: identification of clonotypic gene fusion sequences in neonatal blood spots. Proc Natl Acad Sci U S A. 1997;94:1395013954. 7. Wiemels JL, Cazzaniga G, Daniotti M, et al. Prenatal origin of acute lymphoblastic leukaemia in children. Lancet. 1999;354:1499-1503. 8. Maia AT, Ford AM, Jalali GR, et al. Molecular tracking of leukemogenesis in a triplet pregnancy. Blood. 2001;98:478-482. BLOOD, 15 MAY 2002 VOLUME 99, NUMBER 10 BACKTRACKING AML1-ETO TRANSLOCATIONS 3805 9. Yagi T, Hibi S, Tabata Y, et al. Detection of clonotypic IGH and TCR rearrangements in the neonatal blood spots of infants and children with B-cell precursor acute lymphoblastic leukemia. Blood. 2000;96:264-268. 10. Fasching K, Panzer S, Haas OA, Marschalek R, Gadner H, Panzer-Grumayer ER. Presence of clone-specific antigen receptor gene rearrangements at birth indicates an in utero origin of diverse types of early childhood acute lymphoblastic leukemia. Blood. 2000;95:2722-2724. 11. Downing JR. The AML1-ETO chimaeric transcription factor in acute myeloid leukaemia: biology and clinical significance. Br J Haematol. 1999; 106:296-308. 12. Moorman AV, Roman E, Willett EV, Dovey GJ, Cartwright RA, Morgan GJ. Karyotype and age in acute myeloid leukemia: are they linked? Cancer Genet Cytogenet. 2001;126:155-161. 13. Xiao Z, Greaves MF, Buffler PA, et al. Molecular characterization of genomic AML1-ETO fusions in childhood leukemia. Leukemia. 2001;15:19061913. 14. Aman P. Fusion genes in solid tumors. Semin Cancer Biol. 1999;9:303-318. 15. Wiemels JL, Alexander FE, Cazzaniga G, Biondi A, Mayer SP, Greaves M. Microclustering of TELAML1 breakpoints in childhood acute lymphoblastic leukemia. Genes Chromosomes Cancer. 2000;29:219-228. 16. Reichel M, Gillert E, Nilson I, et al. Fine structure of translocation breakpoints in leukemic blasts with chromosomal translocation t(4;11): the DNA damage-repair model of translocation. Oncogene. 1998;17:3035-3044. 17. Haluska FG, Finver S, Tsujimoto Y, Croce CM. The t(8; 14) chromosomal translocation occurring in B-cell malignancies results from mistakes in V-D-J joining. Nature. 1986;324:158-161. 18. Tsujimoto Y, Gorham J, Cossman J, Jaffe E, Croce CM. The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. Science. 1985;229: 1390-1393. 19. Finette BA, Poseno T, Albertini RJ. V(D)J recombinase-mediated HPRT mutations in peripheral blood lymphocytes of normal children. Cancer Res. 1996;56:1405-1412. 20. Yoshioka M, O'Neill JP, Vacek PM, Finette BA. Gestational age and gender-specific in utero V(D)J recombinase-mediated deletions. Cancer Res. 2001;61:3432-3438. 21. Alexander FE, Patheal SL, Biondi A, et al. Transplacental chemical exposure and risk of infant leukemia with MLL gene fusion. Cancer Res. 2001;61:2542-2546. 22. Nucifora G, Larson RA, Rowley JD. Persistence of the 8;21 translocation in patients with acute myeloid leukemia type M2 in long-term remission. Blood. 1993;82:712-715. 23. Miyamoto T, Nagafuji K, Akashi K, et al. Persistence of multipotent progenitors expressing AML1/ETO transcripts in long-term remission patients with t(8;21) acute myelogenous leukemia. Blood. 1996;87:4789-4796. 24. Kusec R, Laczika K, Knobl P, et al. AML1/ETO fusion mRNA can be detected in remission blood samples of all patients with t(8;21) acute myeloid leukemia after chemotherapy or autologous bone marrow transplantation. Leukemia. 1994;8:735739. 25. Tobal K, Newton J, Macheta M, et al. Molecular quantitation of minimal residual disease in acute myeloid leukemia with t(8;21) can identify patients in durable remission and predict clinical relapse. Blood. 2000;95:815-819. 26. Wattjes MP, Krauter J, Nagel S, Heidenreich O, Ganser A, Heil G. Comparison of nested competitive RT-PCR and real-time RT-PCR for the detection and quantification of AML1/MTG8 fusion tran- scripts in t(8;21) positive acute myelogenous leukemia. Leukemia. 2000;14:329-335. 27. Krauter J, Wattjes MP, Nagel S, et al. Real-time RT-PCR for the detection and quantification of AML1/MTG8 fusion transcripts in t(8;21)-positive AML patients. Br J Haematol. 1999;107:80-85. 28. Stevens RF, Hann IM, Wheatley K, Gray RG. Marked improvements in outcome with chemotherapy alone in paediatric acute myeloid leukemia: results of the United Kingdom Medical Research Council's 10th AML trial. MRC Childhood Leukaemia Working Party. Br J Haematol. 1998; 101:130-140. 29. Woods WG, Neudorf S, Gold S, et al. A comparison of allogeneic bone marrow transplantation, autologous bone marrow transplantation, and aggressive chemotherapy in children with acute myeloid leukemia in remission. Blood. 2001;97: 56-62. 30. Miyamoto T, Weissman IL, Akashi K. AML1/ETOexpressing nonleukemic stem cells in acute myelogenous leukemia with 8;21 chromosomal translocation. Proc Natl Acad Sci U S A. 2000;97: 7521-7526. 31. Higuchi M, O'Brien D, Lenny N, Yang S, Cai Z, Downing JR. Expression of AML1-ETO immortalizes myeloid progenitors and cooperates with secondary mutations to induce granulocytic sarcoma/acute myeloid leukemia [abstract]. Blood. 2000;96:222a. 32. Yuan Y, Zhou L, Miyamoto T, et al. AML1-ETO expression is directly involved in the development of acute myeloid leukemia in the presence of additional mutations. Proc Natl Acad Sci U S A. 2001;98:10398-10403. 33. Ford AM, Fasching K, Panzer-Grumayer ER, Koenig M, Haas OA, Greaves MF. Origins of "late" relapse in childhood acute lymphoblastic leukemia with TEL-AML1 fusion genes. Blood. 2001;98:558-564.