Document 3Q9rNow3YvE6V0D14dELqmrVx
British Journal of Cancer (2005) 93, 811 816 & 2005 Cancer Research UK All rights reserved 0007 0920/05 $30.00
www.bjcancer.com
Non-Hodgkin's lymphoma, obesity and energy homeostasis polymorphisms
EV Willett*,1,4, CF Skibola2,4, P Adamson1, DR Skibola2, GJ Morgan3, MT Smith2 and E Roman1 1Epidemiology and Genetics Unit, Department of Health Sciences, Seebohm Rowntree Building, University of York, York YO10 5DD, UK; 2Division of Environmental Health Sciences, School of Public Health, 140 Earl Warren Hall, University of California, Berkeley, CA 94720-7360, USA; 3Institute of Cancer Research, The Royal Marsden, Downs Road, Sutton, Surrey SM2 5PT, UK
A population-based case control study of lymphomas in England collected height and weight details from 699 non-Hodgkin's lymphoma (NHL) cases and 914 controls. Obesity, defined as a body mass index (BMI) over 30 kg m2 at five years before diagnosis,, was associated with an increased risk of NHL (OR 1.5, 95% CI 1.1 2.1). The excess was most pronounced for diffuse large B-cell lymphoma (OR 1.9, 95% CI 1.3 2.8). Genetic variants in the leptin (LEP 19G4A, LEP 2548G4A) and leptin receptor genes (LEPR 223Q4R), previously shown to modulate NHL risk, as well as a polymorphism in the energy regulatory gene adiponectin (APM1 276G4T), were investigated. Findings varied with leptin genotype, the risks being decreased with LEP 19AA (OR 0.7, 95% CI 0.5 1.0) and increased with LEP 2548GA (OR 1.3, 95% CI 1.0 1.7) and 2548AA (OR 1.4, 95% CI 1.0 1.9), particularly for follicular lymphoma. These genetic findings, which were independent of BMI, were stronger for men than women. British Journal of Cancer (2005) 93, 811 816. doi:10.1038/sj.bjc.6602762 www.bjcancer.com Published online 13 September 2005 & 2005 Cancer Research UK
Keywords: non-Hodgkin's lymphoma; body mass index; SNP; leptin; adiponectin; epidemiology
Apart from a small proportion caused by severe immunosuppression, the cause of the majority of non-Hodgkin's lymphomas (NHL) remains largely unknown. Both over- and undernutrition can suppress immunity via for example leptin, leptin receptor and adiponectin, which are expressed by adipocytes to regulate food intake and energy expenditure (Marti et al, 2001; Samartin and Chandra 2001). Accordingly, it has been suggested that anthropometric measures, reflecting the degree of adiposity, as well as polymorphisms in genes associated with energy homeostasis such as leptin (LEP), leptin receptor (LEPR) and adiponectin (APM1), may increase NHL risk. However, while positive associations have been reported between NHL and anthropometric characteristics (Holly et al, 1999; Calle et al, 2003; Bahl et al, 2004; Pan et al, 2004), others have not (Paffenbarger Jr et al, 1978; Whittemore et al, 1985; Franceschi et al, 1989; La Vecchia et al, 1990; Zhang et al, 1999; Cerhan et al, 2002; Chang et al, 2005). Furthermore, polymorphisms in the LEP (an A to G nucleotide (nt) change at position 19 in the 50-untranslated region (Hager et al, 1998), and a G to A substitution at nt 2548 upstream of the ATG start site (Mammes et al, 1998)) and LEPR (an A to G transition at nt 668 from the start codon that converts glutamine to arginine at codon 223 (223Q4R) (Gotoda et al, 1997)) genes were recently shown to modulate NHL risk (Skibola et al, 2004).
Anthropometric and genetic findings from a large populationbased case control study of NHL carried out in England during the 1990s are presented here. Specifically, the potential aetiological role of body mass index (BMI) and the polymorphisms LEP
*Correspondence: Dr EV Willett; E-mail: eleanor.willett@egu.york.ac.uk 4 These authors contributed equally to this work. Received 25 February 2005; revised 27 July 2005; accepted 27 July 2005;
published online 13 September 2005
19A4G, LEP 2548G4A, and LEPR 223Q4R, as well as a polymorphism in the APM1 gene (a G to T substitution at nt 276 downstream of the ATG start site denoted APM1 276G4T (Hara et al, 2002)), are investigated.
MATERIALS AND METHODS
Details of this case control study are described elsewhere (Willett et al, 2004). Briefly, cases were patients aged 18 64 years newly diagnosed with lymphoma between January 1998 and March 2001. Diagnoses were pathologically confirmed and coded to the World Health Organisation Classification (Fritz et al, 2000), and patients were ineligible if they had a previous diagnosis of lymphoma or HIV. One control per case, individually matched on sex and date of birth, was randomly selected from population registers. All participants were interviewed in person, and asked to provide a blood sample for research purposes. Study subjects were assigned an area-based indicator of deprivation by coding the enumeration districts (ED) where subjects resided at diagnosis/reference date to categories of the 1991 census-derived Townsend scores of EDs across England and Wales (Townsend et al, 1988). The study was conducted with the ethical approval of the United Kingdom MultiRegional Ethical Committee.
At interview, participants were asked what their height and weight was at 5, 10 and 20 years prior to diagnosis/reference date. Body mass index was computed by dividing weight in kilograms by the square of height in metres. Height was categorised based on the observed distributions among controls who were aged 18 years or over at each time point. Body mass index was grouped into underweight (o18.5 kg m2), normal (18.5 24.99 kg m2), grade 1 overweight (25 29.99 kg m2), and grades 2 and 3 overweight
Epidemiology
Non-Hodgkin's lymphoma, obesity and energy homeostasis
EV Willett et al
812 (30 kg m2 or more) (WHO Expert Committee on Physical Status, 1995). DNA was isolated from peripheral blood mononuclear cells using a modified phenol chloroform extraction and was quantified using PicoGreens dsDNA Quantitation kits (Molecular Probes, Eugene, OR, USA), according to the manufacturer's specifications. Samples, blinded to case control status, were genotyped using Taqmans-based assays designed by Applied Biosystems (ABI) (Applied Biosystems, Foster City, CA, USA). Reactions were performed on an ABI 7700 or GeneAmp PCR 9700 System for 10 min at 951C, then 40 cycles of 951C for 15 s and 601C for 1 min; a post-PCR plate read on the ABI 7700 system was used to determine genotype. Genotyping probes and primers used are listed in Table 1. To ensure reproducibility of the genotyping procedure, replicate quality control samples were included with an agreement rate of over 99%. Interviews were conducted with 912 lymphoma patients and 919 controls, 75% of cases and 71% of the controls identified, and blood samples were received from 843 (94%) cases and 829 (95%) controls who were interviewed. Among the 820 Caucasian cases and 826 Caucasian controls who gave a blood sample, 736 (90%) cases and 754 (91%) controls had sufficient DNA to genotype all SNPs under investigation; insufficient or no DNA was available to test all four SNPs for 84 (10%) cases and 72 (9%) controls. The analysis presented here for height and BMI are restricted to 699 Caucasian cases with a confirmed diagnosis of NHL and 914 Caucasian controls, all aged 18 59 at 5 years prior to diagnosis/ reference date, while the analysis of the genotyping data includes 593 Caucasian cases with a confirmed diagnosis of NHL and 754 Caucasian controls. All analyses include controls matched to NHL and Hodgkin's lymphoma (HL) cases. Odds ratios (OR) and 95% confidence intervals (CI), adjusted for sex, age and region, were calculated using unconditional logistic regression; risk estimates for matched analyses were also computed using conditional logistic regression (Breslow and Day, 1980). Tests for trend and for interaction were conducted using the likelihood ratio test. Haplotype frequencies were estimated using log-linear modelling embedded within an expectation maximisation algorithm. All analyses were performed using Stata (StataCorp, 2003).
RESULTS
Among interviewed cases with a confirmed diagnosis, 317 (45%) were diagnosed with diffuse large B-cell lymphoma (DLBCL), 228
(33%) with follicular lymphoma (FL), and 154 (22%) with rarer forms of NHL. A higher proportion of men than women were diagnosed with NHL and this increased with age. The majority of controls (76%) were individually matched to cases on sex and age, and although cases tended to be older due to the inclusion of controls matched to patients diagnosed with Hodgkin's lymphoma, there was little difference between the mean ages of cases (53.5 years) and controls (51.8 years). Cases and controls, who were interviewed or those who were genotyped for energy homeostasis SNPs, were similar with respect to deprivation (data not shown).
Table 2 presents the height distributions of cases and controls. Compared to those whose reported height was between 1.74 and 1.80 m, men of taller or shorter stature were not at increased risk of NHL, DLBCL or FL. With the exception of an increased risk for women less than 1.53 m tall (OR 2.2, 95% CI 0.9 5.1, P 0.07), no excess of NHL was observed for women who were over or under 1.58 1.68 m tall. This elevated risk in the smallest females was evident for DLBCL (OR 2.9, 95% CI 0.9 9.0, P 0.07) and not FL, where rather, risks were decreased among women of above average height (1.69 1.73 m: OR 0.5, 95% CI 0.3 1.0, P 0.06; 41.73 m: OR 0.4, 95% CI 0.2 1.0, P 0.06).
Using the WHO categorisation of BMI (Table 3), risks were estimated relative to cases and controls who were of normal weight-for-height. Persons who were underweight were at decreased risk (OR 0.5, 95% CI 0.2 1.5, P 0.22), while those who were grade 1 overweight (OR 1.2, 95% CI 1.0 1.5, P 0.10), or grades 2 or 3 overweight (OR 1.5, 95% CI 1.1 2.1, P 0.01) were at increased risk of NHL. Tests for trend were significant for NHL and DLBCL but not for FL; a 5 kg m2 rise in BMI increasing the risk of DLBCL by 30% (95% CI 1.2 1.5, Po0.0001). These patterns were similar for men and women (data not shown). With respect to age at diagnosis, there was some suggestion that the risk of NHL associated with being markedly overweight may be more pronounced at younger ages: the OR falling from 2.7 (95% CI 1.2 5.8, P 0.01), to 1.8 (95% CI 1.0 3.3, P 0.04) to 1.2 (95% CI 0.8 1.9, P 0.42) in those aged under 45, 45 54 and 55 years or more, respectively. Further, among the under 45 s, the finding was stronger for DLBCL (OR 3.0, 95% CI 1.2 7.5, P 0.02) than for FL (OR 1.8, 95% CI 0.5 6.3, P 0.33). Within the DLBCL subtype, risks were greater among men aged less than 45 (OR 4.7, 95% CI 1.1 19.4, P 0.03 based on five cases and four controls) than among women of the same age group (OR 2.5, 95% CI 0.7 8.6, P 0.15 based on five cases and 10 controls). Analyses were repeated using anthropometric data at 10 and 20 years before diagnosis/reference date, and using the individually
Table 1 Probes and primers for LEP 19G4A, LEP 2548G4A, LEPR 223Q4R, and APM1 276G4T polymorphisms
SNP
dbSNP rs number
Probe/primer
50-30 sequence
LEP 19G4A
rs2167270
F GGAGCCCCGTAGGAATCG R CCAGCAGAGAAGGAGGAAGGA A VIC-AACCGTTGGCGCTG G 6FAM-AACCGCTGGCGCT
LEP 2548G4A
rs7799039
F TCCCGTGAGAACTATTCTTCTTTTG R CCTGCAACATCTCAGCACTTAGG G VIC-AGGATCAGCGCAAC A 6FAM-ATCAGTGCAACCCT
LEPR 223Q4R
rs1137101
F GTTTGAAAATCACATCTGGTGGAGTA R CATATTTATGGGCTGAACTGACATTAG Q VIC-AGGTGACTGGAAAAT R 6FAM-AGGTGACCGGAAAA
APM1 276G4T
rs1501299
F TTTCATCACAGACCTCCTACACTGA R TCTCCCTGTGTCTAGGCCTTAGTTA GG VIC-TGAATGCCTTCATATAGT T FAM-ATGAATGACTTCATATAGTT
Epidemiology
British Journal of Cancer (2005) 93(7), 811 816
& 2005 Cancer Research UK
Non-Hodgkin's lymphoma, obesity and energy homeostasis EV Willett et al
Table 2 Number of cases and controls, adjusted odds ratios and 95% confidence intervals for height
813
NHLb
DLBCLb
FLb
Heighta
Control
Case
ORc
95% CI
Case
ORc
95% CI
Case
ORc
95% CI
Males p1.65 1.66 1.73
1.74 1.80
1.81 1.88
41.88
495 26 139
214 104 12
361 167 103
19 1.0 0.5 1.9
11 1.4 0.7 3.0
4 0.7 0.2 2.1
103 1.0 0.7 1.4
45 1.1 0.7 1.7
32 1.0 0.6 1.7
151 1
-- 63 1
-- 47 1
--
82 1.1 0.8 1.6
45 1.5 0.9 2.3
19 0.8 0.5 1.5
6 0.7 0.3 1.9
3 0.8 0.2 3.1
1 0.4 0.0 3.0
Females p1.52 1.53 1.57
1.58 1.68
1.69 1.73
41.73
419 43 82
226 56 12
338 150 125
35 2.2 0.9 5.1
10 2.9 0.9 9.0
19 1.1 0.4 3.5
74 1.1 0.6 1.9
28 1.5 0.6 3.3
34 0.9 0.5 1.8
171 1
-- 86 1
-- 55 1
--
38 1.0 0.6 1.6
18 1.6 0.8 3.4
11 0.5 0.3 1.0
20 0.9 0.5 1.6
8 1.4 0.6 3.4
6 0.4 0.2 1.0
aHeight, in metres, at diagnosis/reference date. bNHL non-Hodgkin's lymphoma; DLBCL diffuse large B-cell lymphoma; FL follicular lymphoma. cOdds ratios adjusted for age and region estimated using unconditional logistic regression.
Table 3 Number of cases and controls, adjusted odds ratios and 95% confidence intervals by age for body mass index
NHLb
DLBCLb
FLb
BMIa
Control Case ORc 95% CI Case ORc 95% CI Case ORc 95% CI
Total Underweight Normal Grade 1 Grades 2 and 3
914 14
510 298 89
699 317 228
5 0.5 0.2 1.5
2 0.5 0.1 2.0
00
347 1
-- 159 1
-- 120 1
--
247 1.2 1.0 1.5
99 1.1 0.8 1.4
80 1.2 0.9 1.6
96 1.5 1.1 2.1
54 1.9 1.3 2.8
27 1.2 0.8 2.0
o45 years Underweight Normal Grade 1 Grades 2 and 3
202 4
133 51 14
107
1 0.5 0.1 5.0
60 1
--
26 1.2 0.6 2.1
17 2.7 1.2 5.8
60
1 1.1 0.1 11.0
32 1
--
15 1.2 0.6 2.4
10 3.0 1.2 7.5
29
0
18 1
--
6 1.1 0.4 3.1
4 1.8 0.5 6.3
45 to o55 years Underweight Normal Grade 1 Grades 2 and 3
297 8
174 91 24
243
1 0.2 0.0 1.3
127 1
--
83 1.4 0.9 2.0
31 1.8 1.0 3.3
107
0
58 1
--
32 1.1 0.7 1.9
16 2.0 1.0 4.1
93
0
49 1
--
31 1.3 0.7 2.1
13 1.9 0.9 4.0
55 to o65 years Underweight Normal Grade 1 Grades 2 and 3
415 2
203 156 51
349 150 106
3 1.9 0.3 11.3
1 1.5 0.1 16.6
0
160 1
-- 69 1
--
53 1
--
138 1.1 0.8 1.6
52 1.0 0.6 1.5
43 1.2 0.7 1.8
48 1.2 0.8 1.9
28 1.6 1.0 2.8
10 0.8 0.4 1.6
aBody mass index (BMI) at 5 years prior to diagnosis/reference date where BMI categorised as underweight: o18.5 kg m2; normal: 18.5 24.99 kg m2; grade 1 overweight: 25 29.99 kg m-2; grades 2 and 3 overweight: X30 kg m2 (WHO Expert Committee on Physical Status, 1995). BMI was missing for four cases and three controls as weight was not reported. bNHL non-Hodgkin's lymphoma; DLBCL diffuse large B-cell lymphoma; FL follicular lymphoma. cOdds ratios adjusted for age, sex and region estimated using
unconditional logistic regression.
Epidemiology
matched controls alone and conditional logistic regression, and the findings were similar (data not shown).
Genotype distributions for cases and controls for the LEP 19G4A, LEP 2548G4A, LEPR 223Q4R and APM1 276G4T polymorphisms are shown in Table 4. Control genotype distributions for all SNPs were in Hardy Weinberg equilibrium. Relative to LEP 19GG, the LEP 19AA genotype was inversely associated with FL (OR 0.5, 95% CI 0.3 0.8, P 0.01), but not DLBCL (OR 0.9, 95% CI 0.6 1.4, P 0.70). For LEP 2548G4A, an increased risk for NHL was observed among carriers of the LEP 2548GA (OR 1.3, 95% CI 1.0 1.7, P 0.03) and LEP 2548AA genotypes (OR 1.4, 95% CI 1.0 1.9, P 0.04), particularly for FL (LEP 2548GA: OR 1.6, 95% CI 1.1 2.3, P 0.01; LEP 2548AA:
OR 1.4, 95% CI 0.9 2.3, P 0.12) when compared to LEP 2548GG carriers. Stratifying by sex revealed that among men, the
LEP 19AA genotype was associated with a reduced risk of NHL (OR 0.6, 95% CI 0.4 1.0, P 0.06) and FL (OR 0.3, 95% CI 0.1 0.7, P 0.005), while the LEP 2548AA genotype was associated with an increased risk of NHL (OR 1.6, 95% CI 1.1 2.5, P 0.02), DLBCL (OR 1.6, 95% CI 1.0 2.7, P 0.07) and FL (OR 1.8, 95% CI 0.9 3.5, P 0.10). No associations were
found in women with the exception of an increased risk of FL among carriers of the LEP 223RR (OR 1.9, 95% CI 1.0 3.6, P 0.04) relative to the LEP 223QQ genotype. There were no
differences in genotype distributions between cases and controls
for the APM1 276G4T SNP. Tests for interactions between
& 2005 Cancer Research UK
British Journal of Cancer (2005) 93(7), 811 816
Non-Hodgkin's lymphoma, obesity and energy homeostasis EV Willett et al
814 Table 4 Number of cases and controls, adjusted odds ratios, and 95% confidence intervals for energy homeostasis polymorphisms
NHLa
DLBCLa
FLa
SNPb
Control
Case
ORc
95% CI
Case
ORc
95% CI
Case
ORc
95% CI
Total: LEP 19G4A GG AG AA
754 593 270 210
275 235 1 -- 104 1 -- 86 1 --
357 276 0.9 0.7 1.1 123 0.9 0.7 1.2 102 0.9 0.6 1.3
122
79 0.7 0.5 1.0
43 0.9 0.6 1.4
20 0.5 0.3 0.8
LEP -2548G4A GG GA AA
260 348 145
170 1 -- 81 1 -- 55 1 --
294 1.3 1.0 1.7 128 1.2 0.9 1.6 113 1.6 1.1 2.3
127 1.4 1.0 1.9
59 1.3 0.9 1.9
42 1.4 0.9 2.3
LEPR 223Q4R
QQ 234 188 1 -- 88 1 -- 60 1 --
QR 387 306 1.0 0.8 1.2 144 1.0 0.7 1.3 104 1.0 0.7 1.5
RR
133
99 0.9 0.7 1.3
38 0.8 0.5 1.2
46 1.3 0.8 2.0
APM1 276G4T GG GT TT
398 311 45
341 1
-- 158 1
-- 114 1
--
216 0.8 0.7 1.0
96 0.8 0.6 1.1
82 1.0 0.7 1.3
35 0.9 0.6 1.5
16 0.9 0.5 1.6
13 1.0 0.5 2.0
aNHL non-Hodgkin's lymphoma; DLBCL diffuse large B-cell lymphoma; FL follicular lymphoma. bTest for Hardy Weinberg equilibrium among controls: LEP 19G4A w2 0.12, P 0.73; LEP 2548G4A w2 2.17, P 0.14; LEPR 223Q4R w2 1.55, P 0.21; APM1 276G4T w2 2.41, P 0.12. Samples were not amplifiable for three cases when testing for LEP 19G4A; two cases and one control for LEP 2548G4A; and one case for APM1 276G4T. cOdds ratios adjusted for sex, age and region estimated using
unconditional logistic regression.
SNPs were not statistically significant. LEP 19G4A and LEP 2548G4A among controls, with estimated haplotype frequencies of 2548G/19A, 41.5%; 2548G/19G, 18.5%; 2548A/19G, 39.2%; and 2548A/19A, 0.8%, were in linkage disequilibrium (D 0.95), but despite the individual SNP effects, no associations between haplotypes and either NHL as a whole or FL in particular emerged.
Risks associated with BMI among interviewed and genotyped subjects were similar, with the OR of NHL among the 593 cases and 754 controls who were genotyped being 1.2 (95% CI 0.9 1.5, P 0.16) and 1.4 (95% CI 1.0 2.0, P 0.08) for being grade 1 and grades 2 or 3 overweight, respectively. To assess whether the risk associated with the energy homeostasis polymorphisms differed by BMI, analyses were repeated stratifying the genotyping data by WHO categories of BMI. The risks associated with the variant genotypes did not increase with rising grades of obesity; for example, the risk of NHL did not incline among persons carrying the LEP 2548AA genotype with increasing weight-for-height, from normal weight (OR 1.3, 95% CI 0.9 2.0, P 0.19), through grade 1 overweight (OR 1.5, 95% CI 0.9 2.5, P 0.09), to grades 2 and 3 overweight (OR 0.9, 95% CI 0.3 2.5, P 0.88). Similarly, there was no suggestion that the risk estimates associated with the leptin SNPs varied between persons of normal BMI, grade 1, or grades 2 and 3 obesity (data not shown).
DISCUSSION
Here we present evidence that obesity and variants in the LEP gene may be important in the pathogenesis of NHL. Specifically, we found an association between NHL and excess adiposity estimated using BMI 5 years prior to diagnosis in both men and women, with a greater risk found among patients diagnosed at younger ages (o45 years). Risks were elevated for the two most common NHL subtypes, but the association remained statistically significant only for DLBCL. In contrast, the LEP 19G4A and LEP 2548G4A polymorphisms altered the risk of FL, particularly among men. These SNPs were not associated with risk of DLBCL and, generally,
no associations were observed for LEPR 223Q4R and APM1 276G4T. Given the increasing obesity and lymphoma rates worldwide, our findings may have important public health implications.
While several studies have suggested that the risk of NHL associated with BMI varies little with age and sex (Holly et al, 1999; Calle et al, 2003; Pan et al, 2004; Chang et al, 2005), our study is the first to examine risk by disease subtype, sex and age. With respect to the former, we, like others (Cerhan et al, 2002; Skibola et al, 2004; Chang et al, 2005), found that the risk of DLBCL rose with increasing BMI, but patterns for FL were less consistent. NonHodgkin's lymphoma, and particularly DLBCL, is more common in men than women and the incidence increases with age above 25 years (Clarke and Glaser, 2002; Cartwright et al, 2005). Our observation for DLBCL in young men is based on small numbers, but if real, could reflect the effects of weight gain early in adulthood. Not only does body fat, and hence BMI, increase with age, but the site of fat deposition may also be important men being most likely to accumulate abdominal fat than women (WHO Consultation on Obesity, 2000). Better markers of central, rather than total, adiposity would be waist circumference or waist-to-hip ratio (WHO Consultation on Obesity, 2000), which, up to now, have only been reported in one study of women, but no association with NHL was found (Cerhan et al, 2002). If weight gain in early adulthood is not responsible, our results could instead suggest that obesity from childhood is a risk factor for NHL. It seems unlikely however that nutrition during childhood, linked to adult stature (Silventoinen, 2003), increases NHL risk, since generally little evidence of an association with height has been presented either here or elsewhere (Whittemore et al, 1985; La Vecchia et al, 1990; Zhang et al, 1999; Cerhan et al, 2002). Alternatively, it may be that an underlying genetic component of obesity is involved in the pathogenesis of NHL.
Leptin, an adipokine which circulates at levels proportional to adipose tissue mass, regulates immune function as well as nutritional status (Otero et al, 2005). As circulating levels increase, leptin acts to modulate food intake, but in obesity, its rise with
British Journal of Cancer (2005) 93(7), 811 816
& 2005 Cancer Research UK
Epidemiology
increasing body fat has limited effect on satiety, suggesting negative regulators of leptin and insulin signalling, such as leptin receptor and adiponectin, are present (Bell et al, 2005). In the absence of measured plasma levels before the diagnosis of NHL, long-term variation in production of these adiponectins may be indicated by the polymorphisms investigated here, since the LEP 19G, LEP 2548A and LEPR 223R alleles have been associated with elevated leptin levels, and the APM1 276T allele with lower adiponectin levels (Hoffstedt et al, 2002; van Rossum et al, 2003; Filippi et al, 2004). Further, these polymorphisms have been linked with an obese phenotype in some Caucasian populations (Li et al, 1999; Mammes et al, 2000; Quinton et al, 2001; Yiannakouris et al, 2001; Nieters et al, 2002; Filippi et al, 2004; Jiang et al, 2004). Previously, Skibola et al (2004) reported that, relative to the LEP 19AA genotype, carriers of the LEP 19G allele were at increased risk of NHL, particularly FL (OR 1.9, 95% CI 1.0 3.6). Using LEP 19GG as the referent group, the recalculated FL risk estimate for the LEP 19AA genotype is 0.6 (95% CI 0.3 1.3), similar to the OR of 0.5 (95% CI 0.3 0.8) presented here. As has been observed elsewhere, the BMIs of our controls were not correlated with LEP 19G4A (r 0.014, P 0.70) (Karvonen et al, 1998; Lucantoni et al, 2000), LEP 2548G4A (r 0.013, P 0.72) (Mammes et al, 1998; Le Stunff et al, 2000), LEPR 223Q4R (r 0.008, P 0.83) (Gotoda et al, 1997; Rosmond et al, 2000; Wauters et al, 2001) or APM1 276G4T (r 0.024, P 0.51) (Menzaghi et al, 2002; Fumeron et al, 2004). Moreover, this and the previous report by Skibola et al found little evidence that risks associated with BMI varied by genotype.
Obesity can induce a state of leptin and insulin resistance, chronic low-grade inflammation, and increased leptin, tumour necrosis factor (TNF)-a, IL-6 and C reactive protein serum levels (Marti et al, 2001). These proinflammatory mediators can activate a number of signalling pathways including nuclear factor (NF)-kB that result in antiapoptotic and proliferative behaviour in B-cells. Recently, DLBCL subtypes have been characterised by NF-kB gene expression signatures, suggesting the significance of activation of this transcription factor in DLBCL pathogenesis (Rosenwald and Staudt, 2003). Increased risk of FL associated with a high leptin producer phenotype (LEP-2548AA), or reduced risk associated with a low leptin producer phenotype (LEP 19AA), may relate to leptin's action in upregulating expression of the antiapoptotic BCL-2 protein in B-cells through the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathways. Most FL have a t(14;18) chromosome translocation resulting in BCL-2 dysregulation and overexpression. Leptin also increases expression of matrix metalloproteinases and tissue inhibitors of metallo-
Non-Hodgkin's lymphoma, obesity and energy homeostasis EV Willett et al
proteinases, which are associated with aggressive disease, neoplastic growth and angiogenesis in B-cell lymphomas.
This study has a high level of case ascertainment and diagnostic confirmation. As with all case control studies of this type, however, the possibility that the findings may reflect bias in the case and/or control populations needs to be considered. In our study, participants who resided in affluent areas were, on average, of smaller stature and greater BMI than those who resided in deprived areas. This pattern agrees with that seen in most national surveys (Joint Health Surveys Unit, 2003), and it is possible that the increased risks may have arisen from differential case control participation. However, adjustment for deprivation did not alter the risk estimates for height or BMI. A further limitation relates to the self-reported nature of the anthropometric data analysed. Compared to a sample of the British population with anthropometric measurements (National Center for Social Research, 2004), our controls were taller and lighter, leading to a reduction in their derived BMI. It is, however, unlikely that cases estimated their height and weight differently from controls, as the hypothesis that obesity is related to NHL is not widely known.
In conclusion, our findings raise the possibility that obesity may increase risk of NHL as a whole, and DLBCL risk in particular. Our findings were most marked among men and those diagnosed at a comparatively young age (o45 years). Although the SNPs involved in energy homeostasis investigated in our study did not modify the risk of NHL associated with obesity, independent effects were seen for FL with the LEP 19G4A and LEP 2548G4A SNPs, irrespective of adiposity. Previous reports of NHL and BMI have been inconsistent, with little investigation of disease subtypes. New initiatives, aimed at pooling data from studies around the world including the one reported here (Boffetta et al, 2003), will hopefully provide further insight into the association between lymphoma and BMI.
815
ACKNOWLEDGEMENTS
This work was supported by the Leukaemia Research Fund of Great Britain, NIH Grant RO1-CA104862 from the US National Cancer Institute (MT Smith, PI) and by the National Foundation for Cancer Research. We thank all consultants, hospital staff, general practitioners and interviewees who participated in the study. Our thanks also go to Andrew Jack and Bridget Wilkins for confirming the patients' diagnoses, Sara Rollinson and Heather Kesby for sample management and DNA extraction, and to the study staff.
Epidemiology
REFERENCES
Bahl S, Cotterchio M, Kreiger N, Klar N (2004) Antidepressant medication use and non-Hodgkin's lymphoma risk: no association. Am J Epidemiol 160: 566 575
Bell CG, Walley AJ, Froguel P (2005) The genetics of human obesity. Nat Rev Genet 6: 221 234
Boffetta P, Linet M, Armstrong B (2003) The Interlymph collaboration: a consortium of molecular epidemiological studies of non-Hodgkin's lymphoma. Proc Am Assoc Cancer Res 44: 1579
Breslow NE, Day NE (1980) Statistical Methods in Cancer Research. Volume 1 The Analysis of Case Control Studies. Lyon: International Agency for Research on Cancer
Calle EE, Rodriguez C, Walker-Thurmond K, Thun MJ (2003) Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. N Engl J Med 348: 1625 1638
Cartwright R, Wood H, Quinn M (2005) Non-Hodgkin's lymphoma. In Cancer Atlas of the United Kingdom and Ireland 1991 2000 Quinn M, Wood H, Cooper N, Rowan S (eds). London: Palgrave Macmillan
Cerhan JR, Janney CA, Vachon CM, Habermann TM, Kay NE, Potter JD, Sellers TA, Folsom AR (2002) Anthropometric characteristics, physical activity, and risk of non-Hodgkin's lymphoma subtypes and B-cell chronic lymphocytic leukemia: a prospective study. Am J Epidemiol 156: 527 535
Chang ET, Hjalgrim H, Smedby KE, Akerman M, Tani E, Johnsen HE, Glimelius B, Adami HO, Melbye M (2005) Body mass index and risk of malignant lymphoma in Scandinavian men and women. J Natl Cancer Inst 97: 210 218
Clarke CA, Glaser SL (2002) Changing incidence of non-Hodgkin lymphomas in the United States. Cancer 94: 2015 2023
Filippi E, Sentinelli F, Trischitta V, Romeo S, Arca M, Leonetti F, Di Mario U, Baroni MG (2004) Association of the human adiponectin gene and insulin resistance. Eur J Hum Genet 12: 199 205
Franceschi S, Serraino D, Bidoli E, Talamini R, Tirelli U, Carbone A, La Vecchia C (1989) The epidemiology of non-Hodgkin's lymphoma in the north-east of Italy: a hospital-based case control study. Leuk Res 13: 465 472
& 2005 Cancer Research UK
British Journal of Cancer (2005) 93(7), 811 816
Non-Hodgkin's lymphoma, obesity and energy homeostasis
EV Willett et al
816
Fritz A, Percy C, Jack A, Shanmugaratnam K, Sobin L, Parkin DM, Whelan S (2000) International Classification for Diseases for Oncology. Geneva: World Health Organisation
Fumeron F, Aubert R, Siddiq A, Betoulle D, Pean F, Hadjadj S, Tichet J, Wilpart E, Chesnier MC, Balkau B, Froguel P, Marre M (2004) Adiponectin gene polymorphisms and adiponectin levels are independently associated with the development of hyperglycemia during a 3-year period: the epidemiologic data on the insulin resistance syndrome prospective study. Diabetes 53: 1150 1157
Gotoda T, Manning BS, Goldstone AP, Imrie H, Evans AL, Strosberg AD, McKeigue PM, Scott J, Aitman TJ (1997) Leptin receptor gene variation and obesity: lack of association in a white British male population. Hum Mol Genet 6: 869 876
Hager J, Clement K, Francke S, Dina C, Raison J, Lahlou N, Rich N, Pelloux V, Basdevant A, Guy-Grand B, North M, Froguel P (1998) A polymorphism in the 50 untranslated region of the human ob gene is associated with low leptin levels. Int J Obes Relat Metab Disord 22: 200 205
Hara K, Boutin P, Mori Y, Tobe K, Dina C, Yasuda K, Yamauchi T, Otabe S, Okada T, Eto K, Kadowaki H, Hagura R, Akanuma Y, Yazaki Y, Nagai R, Taniyama M, Matsubara K, Yoda M, Nakano Y, Tomita M, Kimura S, Ito C, Froguel P, Kadowaki T (2002) Genetic variation in the gene encoding adiponectin is associated with an increased risk of type 2 diabetes in the Japanese population. Diabetes 51: 536 540
Hoffstedt J, Eriksson P, Mottagui-Tabar S, Arner P (2002) A polymorphism in the leptin promoter region (2548 G/A) influences gene expression and adipose tissue secretion of leptin. Horm Metab Res 34: 355 359
Holly EA, Lele C, Bracci PM, McGrath MS (1999) Case control study of non-Hodgkin's lymphoma among women and heterosexual men in the San Francisco Bay Area, California. Am J Epidemiol 150: 375 389
Jiang Y, Wilk JB, Borecki I, Williamson S, DeStefano AL, Xu G, Liu J, Ellison RC, Province M, Myers RH (2004) Common variants in the 50 region of the leptin gene are associated with body mass index in men from the National Heart, Lung, and Blood Institute Family Heart Study. Am J Hum Genet 75: 220 230
Joint Health Surveys Unit (2003) Health Survey for England 2003. Summary of key findings
Karvonen MK, Pesonen U, Heinonen P, Laakso M, Rissanen A, Naukkarinen H, Valve R, Uusitupa MI, Koulu M (1998) Identification of new sequence variants in the leptin gene. J Clin Endocrinol Metab 83: 3239 3242
La Vecchia C, Negri E, Parazzini F, Boyle P, D'Avanzo B, Levi F, Gentile A, Franceschi S (1990) Height and cancer risk in a network of case control studies from northern Italy. Int J Cancer 45: 275 279
Le Stunff C, Le Bihan C, Schork NJ, Bougneres P (2000) A common promoter variant of the leptin gene is associated with changes in the relationship between serum leptin and fat mass in obese girls. Diabetes 49: 2196 2200
Li WD, Reed DR, Lee JH, Xu W, Kilker RL, Sodam BR, Price RA (1999) Sequence variants in the 50 flanking region of the leptin gene are associated with obesity in women. Ann Hum Genet 63(part 3): 227 234
Lucantoni R, Ponti E, Berselli ME, Savia G, Minocci A, Calo G, de Medici C, Liuzzi A, Di Blasio AM (2000) The A19G polymorphism in the 50 untranslated region of the human obese gene does not affect leptin levels in severely obese patients. J Clin Endocrinol Metab 85: 3589 3591
Mammes O, Betoulle D, Aubert R, Giraud V, Tuzet S, Petiet A, ColasLinhart N, Fumeron F (1998) Novel polymorphisms in the 50 region of the LEP gene: association with leptin levels and response to low-calorie diet in human obesity. Diabetes 47: 487 489
Mammes O, Betoulle D, Aubert R, Herbeth B, Siest G, Fumeron F (2000) Association of the G-2548A polymorphism in the 50 region of the LEP gene with overweight. Ann Hum Genet 64: 391 394
Marti A, Marcos A, Martinez JA (2001) Obesity and immune function relationships. Obes Rev 2: 131 140
Menzaghi C, Ercolino T, Di Paola R, Berg AH, Warram JH, Scherer PE, Trischitta V, Doria A (2002) A haplotype at the adiponectin locus is
associated with obesity and other features of the insulin resistance syndrome. Diabetes 51: 2306 2312 National Centre for Social Research (2004) Health survey for England 2003. Department of Health: London Nieters A, Becker N, Linseisen J (2002) Polymorphisms in candidate obesity genes and their interaction with dietary intake of n-6 polyunsaturated fatty acids affect obesity risk in a sub-sample of the EPIC-Heidelberg cohort. Eur J Nutr 41: 210 221 Otero M, Lago R, Lago F, Casanueva FF, Dieguez C, Gomez-Reino JJ, Gualillo O (2005) Leptin, from fat to inflammation: old questions and new insights. FEBS Lett 579: 295 301 Paffenbarger Jr RS, Wing AL, Hyde RT (1978) Characteristics in youth predictive of adult-onset malignant lymphomas, melanomas, and leukemias: brief communication. J Natl Cancer Inst 60: 89 92 Pan SY, Johnson KC, Ugnat AM, Wen SW, Mao Y (2004) Association of obesity and cancer risk in Canada. Am J Epidemiol 159: 259 268 Quinton ND, Lee AJ, Ross RJ, Eastell R, Blakemore AI (2001) A single nucleotide polymorphism (SNP) in the leptin receptor is associated with BMI, fat mass and leptin levels in postmenopausal Caucasian women. Hum Genet 108: 233 236 Rosenwald A, Staudt LM (2003) Gene expression profiling of diffuse large B-cell lymphoma. Leuk Lymphoma 44(Suppl 3): S41 S47 Rosmond R, Chagnon YC, Holm G, Chagnon M, Perusse L, Lindell K, Carlsson B, Bouchard C, Bjorntorp P (2000) Hypertension in obesity and the leptin receptor gene locus. J Clin Endocrinol Metab 85: 3126 3131 Samartin S, Chandra RK (2001) Obesity, overnutrition and the immune system. Nutr Res 21: 243 262 Silventoinen K (2003) Determinants of variation in adult body height. J Biosoc Sci 35: 263 285 Skibola CF, Holly EA, Forrest MS, Hubbard A, Bracci PM, Skibola DR, Hegedus C, Smith MT (2004) Body mass index, leptin and leptin receptor polymorphisms, and non-hodgkin lymphoma. Cancer Epidemiol Biomarkers Prev 13: 779 786 StataCorp (2003) Stata Statistical Software: Release 8.2. College Station, TX, Stata Corporation Townsend P, Phillimore P, Beattie A (1988) Health and Deprivation: Inequality and the North. London: Croom Helm van Rossum CT, Hoebee B, van Baak MA, Mars M, Saris WH, Seidell JC (2003) Genetic variation in the leptin receptor gene, leptin, and weight gain in young Dutch adults. Obes Res 11: 377 386 Wauters M, Mertens I, Rankinen T, Chagnon M, Bouchard C, Van Gaal L (2001) Leptin receptor gene polymorphisms are associated with insulin in obese women with impaired glucose tolerance. J Clin Endocrinol Metab 86: 3227 3232 Whittemore AS, Paffenbarger Jr RS, Anderson K, Lee JE (1985) Early precursors of site-specific cancers in college men and women. J Natl Cancer Inst 74: 43 51 WHO Consultation on Obesity (2000) Obesity: preventing and managing the global epidemic: report of a WHO consultation. WHO Technical Report Series 894, pp 1 253. Geneva, Switzerland: World Health Organization WHO Expert Committee on Physical Status (1995) Physical Status: The Use and Interpretation of Anthropometry: Report of a WHO Expert Committee. WHO Technical Report Series 854, pp 1 415. Geneva, Switzerland: World Health Organization Willett EV, Smith AG, Dovey GJ, Morgan GJ, Parker J, Roman E (2004) Tobacco and alcohol consumption and the risk of non-Hodgkin lymphoma. Cancer Causes Control 15: 771 780 Yiannakouris N, Yannakoulia M, Melistas L, Chan JL, Klimis-Zacas D, Mantzoros CS (2001) The Q223R polymorphism of the leptin receptor gene is significantly associated with obesity and predicts a small percentage of body weight and body composition variability. J Clin Endocrinol Metab 86: 4434 4439 Zhang S, Hunter DJ, Rosner BA, Colditz GA, Fuchs CS, Speizer FE, Willett WC (1999) Dietary fat and protein in relation to risk of non-Hodgkin's lymphoma among women. J Natl Cancer Inst 91: 1751 1758
Epidemiology
British Journal of Cancer (2005) 93(7), 811 816
& 2005 Cancer Research UK