Document Qr8G0g79Kd055vXyD8embNR7

short report Polymorphisms in innate immunity genes and risk of nonHodgkin lymphoma Matthew S. Forrest ,1 Christine F. Skibola,1 Tracy J. Lightfoot,2 Paige M. Bracci,3 Eleanor V. Willett,2 Martyn T. Smith,1 Elizabeth A. Holly3 and Eve Roman2 1Division of Environmental Health Sciences, School of Public Health, University of California, Berkeley, CA, USA, 2Epidemiology & Genetics Unit, Department of Health Sciences, University of York, York, UK, and 3Department of Epidemiology and Biostatistics, University of California, San Francisco, CA, USA Received 14 March 2006; accepted for publication 1 May 2006 Correspondence: Dr C Skibola, Division of Environmental Health Sciences, School of Public Health, University of California, Berkeley, CA 94720-7360, USA. E-mail: chrisfs@berkeley.edu Summary Genetic variation in innate immunity may alter host-pathogen defence mechanisms and promote aberrant immune responses and non-Hodgkin lymphoma (NHL). To test this hypothesis, we investigated polymorphisms in innate immune genes in a pooled analysis of two population-based casecontrol studies of NHL from the San Francisco Bay Area (308 cases, 684 controls) and UK (596 cases, 758 controls). The caspase recruitment domaincontaining protein 1007fs homozygote variant was positively associated with NHL risk (odds ratios (OR) 31, 95% confidence intervals (CI) 1188), whereas the toll-like receptor 4 1063A>G variant allele was inversely associated with diffuse large cell lymphoma (OR 067, 95% CI 045 099). These results suggest that variation in innate immune genes may alter NHL susceptibility. Keywords: lymphoma, infections, innate immunity, single nucleotide polymorphisms. Immunosuppression and infections have been associated with increased risk of non-Hodgkin lymphoma (NHL) and NHL subtypes. The initial response to infection is mounted by the innate immune system that enables the host to discriminate among pathogens and to trigger subsequent adaptive immune responses through antigen-specific mechanisms. Functional polymorphisms in highly polymorphic innate immunityrelated genes have been identified including the toll-like receptor (TLR) family, caspase recruitment domain-containing protein 15 (CARD15/NOD2), mannose binding lectin (protein C) 2 (MBL2), macrophage migration inhibitory factor (MIF), p22phox (CYBA) and cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) (Arbour et al, 2000; Ogura et al, 2001). These polymorphisms have been associated with increased risk of various autoimmune diseases and infections (Brand et al, 2005). Thus, an altered immune response arising because of genetic variation in the innate immune system may influence NHL susceptibility. To test this hypothesis, two large population-based casecontrol studies of NHL, conducted in the San Francisco Bay Area and the UK, were examined for polymorphisms in genes involved in innate immunity including a frameshift polymorphism that results in a truncated protein (Ogura et al, 2001) in CARD15, 1007fs (rs2066847/ rs5743293); a promoter single nucleotide polymorphism (SNP), -173G>C (rs755622), in MIF; a 3'-untranslated region SNP 640A>G (rs1049255) in CYBA; and four non-synonymous coding SNPs: 49A>G (17Thr>Ala, rs231775) in CTLA4, CYBA 242C>T (72His>Tyr, rs4673), MBL2 226G>A (54Gly>Asp, rs1800450) and TLR4 1063A>G (299Asp>Gly, rs4986790). Methods Full details of the casecontrol study designs of the US (n 1591 cases, n 2515 controls) and UK (n 700 cases, n 915 controls) are described elsewhere (Holly & Bracci, 2003; Willett et al, 2004). Study protocols and procedures were approved by the University of California, San Francisco (UCSF) Committee on Human Research and the UK MultiRegional Ethics Committee respectively. For the US study, all participants provided written informed consent prior to interview and to venipuncture. In the UK, participating subjects were asked to consent to being interviewed, to allow access to their medical records and to give mouthwash and blood samples. DNA from 904 cases (308 US; 596 UK) and 1442 controls (684 US; 758 UK) was genotyped using the Custom TaqMan Genotyping Assays (Applied Biosystems Foster City, CA, USA) as described previously (Skibola et al, 2004). Probes and primers are listed in Table I. The majority of these patients were diagnosed with pathologically confirmed doi:10.1111/j.1365-2141.2006.06141.x Journal Compilation 2006 Blackwell Publishing Ltd No claim to original US government works British Journal of Haematology, 134, 180183 Short Report Table I. Primers and TaqManTM probes used for innate immunity polymorphisms. SNP CTLA4 49 A>G CYBA 242 C>T CYBA 640A>G MBL 226G>A MIF -173G>C CARD15 1007fs TLR4 1063A>G RS number rs231775 rs4673 rs1049255 rs1800450 rs755622 rs2066847/ rs5743293 rs4986790 Probe/primer F R G A F R C T F R A G F R G A F R G C F R C F R A G 53 Sequence GGCACAAGGCTCAGCTGAAC AGAAGACAGGGATGAAGAGAAGAAAA VIC- AGGTCCTGGCAGCC 6FAM- AGGTCCTGGTAGCCAG CGTCTCGCCTTCCTCCCT GGGCCCGAACAGCTTCA VIC- CATGTGCTTCTGTCC 6FAM- CGGTCATGTACTTCT GACCGACGAGGTCGTGTGA GGCTTCGCTGCATTTATTGC VIC- CCTCCCACCAGGTG 6FAM- CCCTCCCGCCAGG GGCTTCCCAGGCAAAGATG AGCCCAACACGTACCTGGTT VIC- CCTTGGTGCCATCA 6FAM- CCTTGGTGTCATCAC CGATTTCTAGCCGCCAAGTG AGCAACCGCCGCTAAGC VIC- AGAACAGGTTGGAGCG 6FAM- AGAACAGCTTGGAGCG CAGACTTCCAGGATGGTGTCATT TGTCCAATAACTGCATCACCTACCT VIC-AGGCCCTTGAAAGG 6FAM-CAGGCCCCTTGAA CCATTGAAGAATTCCGATTAGCATA TCACCAGGGAAAATGAAGAAACAT VIC- CCTCGATGATATTATT 6FAM- CTCGATGGTATTATTG SNP, single nucleotide polymorphism; rs, reference SNP. NHL subtypes, follicular lymphoma (FL, 323) or diffuse largecell lymphoma (DLCL, 370). Odds ratios (ORs) and 95% confidence intervals (CIs) adjusted for age, sex and study geographic location were estimated (hereafter called risks) using unconditional logistic regression in analyses of white non-Hispanic, human immunodeficiency virus (HIV)-negative participants. Results and discussion Study-specific genotype distributions for the CTLA4 49A>G, CYBA 242C>T, CYBA 640A>G, CARD15 1007fs, MBL2 226G>A, MIF-173G>C and TLR4 1063A>G polymorphisms are listed in Supplemental Table S1. Control genotype frequencies were in HardyWeinberg equilibrium and similar to frequencies in other Caucasian populations (Brand et al, 2005). Allele frequencies were comparable across populations, which enabled the data to be pooled for analyses (Table II). The CARD15 1007fs homozygous variant genotype was positively associated with risk of all NHL (OR 31, 95% CI: 1188), but results by subtype were unstable and imprecise because of few homozygous variants (Table II). Although the TLR4 1063G variant was not associated with NHL, an inverse association was observed with DLCL (OR 067, 95% CI 045099). There were no genegene interactions between CARD15 1007fs and TLR4 1063A>G. This could be due partially to low variant allele frequencies (006 and 013 respectively). No associations were found between NHL and CTLA4 49A>G, CYBA 242 C>T and 640A>G, MBL2 226G>A andMIF-173G>C polymorphisms or CYBA haplotypes. CARD15/NOD2 and TLR4 are key regulators of innate immune responses to bacteria. NOD2 exerts antimicrobial activity to prevent pathogen invasion through a nuclear factor (NF)jB-mediated pathway of inflammation and apoptosis (Chamaillard et al, 2003). The CARD15 1007fs polymorphism has been linked to autoimmune disorders, such as Crohn's disease, psoriasis and the chronic inflammatory disorder, Blau's syndrome (Yamada & Ymamoto, 2005), and all have been linked to NHL. Impairment of the immune system by the CARD15 1007fs polymorphism may contribute to NHL risk through chronic activation of alternate recognition receptors, such as the TLRs, that can lead to T-cell-induced NFjB activation and pro-inflammatory cytokine release (Chamaillard et al, 2003). A recent investigation of the CARD15 1007fs polymorphism in the International Lymphoma Epidemiology Consortium (InterLymph) of 3586 cases and 4018 controls found that the homozygous variant genotype was associated with an Journal Compilation 2006 Blackwell Publishing Ltd No claim to original US government works British Journal of Haematology, 134, 180183 181 Short Report Table II. Innate immunity genotype frequencies, odds ratios (OR), and 95% confidence intervals (CI) in non-Hodgkin lymphoma (NHL) cases and controls using homozygous wild types as the reference. Control (%) All NHL cases (%) OR (95% CI) DLCL (%) OR (95% CI) FL (%) OR (95% CI) CTLA4 49 A>G AA 546 (38) AG 682 (48) GG 199 (14) AG/GG 881 (62) pTrend Total 1427 CYBA 640A>G AA 337 (23) AG 739 (51) GG 364 (25) AG/GG 1103 (77) pTrend Total 1440 CYBA 242 C>T CC 634 (44) CT 657 (46) TT 150 (10) CT/TT 807 (56) pTrend Total 1441 CARD15 1007fs 1378 (96) -C 54 (4) CC 1 (0001) -C/CC 55 (4) pTrend Total 1433 MBL 226G>A GG 1047 (73) GA 346 (24) AA 37 (3) GA/AA 383 (27) pTrend Total 1430 MIF -173G>C GG 954 (67) GC 415 (29) CC 57 (4) GC/CC 472 (33) pTrend Total 1426 TLR4 1063A>G AA 1254 (88) AG 172 (12) GG 6 (04) AG/GG 178 (12) pTrend Total 1432 353 (40) 410 (46) 124 (14) 534 (60) 887 230 (26) 451 (50) 221 (25) 672 (74) 902 410 (45) 390 (43) 102 (11) 492 (55) 902 854 (95) 38 (4) 7 (1) 45 (5) 308 661 (74) 216 (24) 17 (2) 233 (26) 894 609 (68) 252 (28) 33 (4) 285 (32) 894 794 (88) 106 (12) 3 (03) 109 (12) 903 094 (07811) 095 (07312) 094 (07911) 056 094 (07612) 093 (07412) 094 (07711) 058 091 (07611) 11 (08014) 094 (07911) 088 042 (01313) 31 (1188) 15 (09822) 002 10 (08312) 076 (04214) 099 (08112) 069 094 (07811) 083 (05313) 093 (07813) 036 092 (07112) 084 (02035) 092 (07112) 052 138 (38) 172 (47) 55 (15) 227 (62) 365 91 (25) 179 (49) 98 (27) 277 (75) 368 152 (41) 172 (47) 44 (12) 216 (59) 368 356 (97) 10 (3) 2 (050) 12 (3) 368 268 (73) 90 (25) 7 (2) 97 (27) 365 246 (67) 106 (29) 15 (4) 121 (33) 367 336 (91) 33 (9) 1 (03) 34 (9) 370 099 (07713) 11 (07415) 10 (07913) 080 092 (06912) 1 (07414) 095 (07312) 087 11 (08514) 13 (08619) 11 (08814) 024 080 (04016) 93 (080108) 095 (05018) 076 10 (07914) 077 (03418) 1 (07713) 089 098 (07613) 091 (05016) 097 (07612) 077 067 (04510) 057 (00749) 067 (045-.99) 004 131 (41) 147 (47) 38 (12) 185 (58) 316 83 (26) 168 (52) 72 (22) 240 (74) 323 144 (45) 137 (43) 39 (12) 176 (55) 320 302 (94) 18 (6) 2 (060) 20 (6) 322 237 (74) 76 (24) 8 (2) 84 (26) 321 226 (71) 82 (26) 11 (3) 93 (29) 319 278 (87) 41 (13) 1 (03) 42 (13) 320 090 (06912) 079 (05312) 088 (06811) 022 096 (07113) 083 (05812) 092 (06912) 030 091 (07012) 12 (07817) 096 (07512) 084 17 (1030) 86 (07796) 19 (1132) 001 098 (07413) 10 (04622) 098 (07413) 092 083 (06311) 077 (04015) 082 (06311) 016 10 (07115) .77 (00965) 10 (07115) 097 DLCL, diffuse large-cell lymphoma; FL, follicular lymphoma. elevated, but imprecise, risk estimate for NHL (OR 23, 95% CI 012135) (Rothman et al, 2006). Because of its relative rarity in Caucasian populations, this polymorphism will need to be further investigated in larger studies as part of the InterLymph consortium to determine its impact on lymphoma risk. Journal Compilation 2006 Blackwell Publishing Ltd 182 No claim to original US government works British Journal of Haematology, 134, 180183 Short Report Expressed on monocytes and on marginal zone B cells, TLR4 facilitates transmembrane signalling of lipopolysaccharide activation. Further, TLR4 mediates tolerance and multiple stages of B-cell activation, including development of the germinal-centre reaction and differentiation of B cells into antibody-producing plasma cells. Studies have shown that the TLR4 1063G allele attenuates TLR4 receptor signalling, NFjB activation and inflammatory responses. Notably, whereas the TLR4 1063G allele was inversely associated with DLCL in the present study and previously with gastric lymphoma (Hellmig et al, 2005), it has been positively associated with type-2 helper T-cell (TH2)-driven asthma and chronic obstructive pulmonary diseases (Rohde et al, 2006). These disparate effects on disease risk may relate to the decrease in interleukin-12 and interferon-gamma associated with the TLR4 1063G allele, which steers the immune system toward an allergy-driven TH2 phenotype. Recent results of an inverse association between a history of atopic conditions and NHL risk (Holly & Bracci, 2003; Grulich et al, 2005) further support the role of a TH2dominated immune response in reduced susceptibility to NHL. In conclusion, this pooled analysis of two large casecontrol studies showed that the TLR4 1063A>G and CARD15 1007fs polymorphisms may influence NHL risk by altering host immune responsiveness to microbial agents. Results from genetic association studies may be susceptible to effects of multiple testing and population heterogeneity (although we restricted our analyses to white non-Hispanics). Meta-analyses of these SNPs and further analyses of additional polymorphisms/haplotypes in these genes will help determine their role in lymphomagenesis. Acknowledgements This work was supported by the Leukaemia Research Fund of Great Britain, National Institutes of Health (NIH) grant numbers CA104862 (M.T. Smith), CA45614, CA89745, CA87014 (E.A. Holly), and by the National Foundation for Cancer Research. We thank all consultants, hospital staff, general practitioners, and interviewees who participated in the study. References Arbour, N.C., Lorenz, E., Schutte, B.C., Zabner, J., Kline, J.N., Jones, M., Frees, K., Watt, J.L. & Schwartz, D.A. (2000) TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nature Genetics, 25, 187191. Brand, S., Staudinger, T., Schnitzler, F., Pfennig, S., Hofbauer, K., Dambacher, J., Seiderer, J., Tillack, C., Konrad, A., Crispin, A., Goke, B., Lohse, P. & Ochsenkuhn, T. (2005) The role of Toll-like receptor 4 Asp299Gly and Thr399Ile polymorphisms and CARD15/ NOD2 mutations in the susceptibility and phenotype of Crohn's disease. Inflammatory Bowel Diseases, 11, 645652. Chamaillard, M., Philpott, D., Girardin, S.E., Zouali, H., Lesage, S., Chareyre, F., Bui, T.H., Giovannini, M., Zaehringer, U., PenardLacronique, V., Sansonetti, P.J., Hugot, J.P. & Thomas, G. (2003) Gene-environment interaction modulated by allelic heterogeneity in inflammatory diseases. Proceedings of the National Academy of Sciences of the United States of America, 100, 34553460. Grulich, A.E., Vajdic, C.M., Kaldor, J.M., Hughes, A.M., Kricker, A., Fritschi, L., Turner, J.J., Milliken, S., Benke, G. & Armstrong, B.K. (2005) Birth order, atopy, and risk of non-Hodgkin lymphoma. Journal of the National Cancer Institute, 97, 587594. Hellmig, S., Fischbach, W., Goebeler-Kolve, M.E., Folsch, U.R., Hampe, J. & Schreiber, S. (2005) Association study of a functional Toll-like receptor 4 polymorphism with susceptibility to gastric mucosa-associated lymphoid tissue lymphoma. Leukemia and Lymphoma, 46, 869872. Holly, E.A. & Bracci, P.M. (2003) Population-based study of nonHodgkin lymphoma, histology, and medical history among human immunodeficiency virus-negative participants in San Francisco. American Journal of Epidemiology, 158, 316327. Ogura, Y., Bonen, D.K., Inohara, N., Nicolae, D.L., Chen, F.F., Ramos, R., Britton, H., Moran, T., Karaliuskas, R., Duerr, R.H., Achkar, J.P., Brant, S.R., Bayless, T.M., Kirschner, B.S., Hanauer, S.B., Nunez, G. & Cho, J.H. (2001) A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. Nature, 411, 603606. Rohde, G., Klein, W., Arinir, U., Hagedorn, M., Duerig, N., Epplen, J., Gillissen, A., Schultze-Werninghaus, G. & Bauer, T. (2006) Association of the ASP299GLY TLR4 polymorphism with COPD. Respiratory Medicine, 100, 8926. Rothman, N., Skibola, C.F., Wang, S.S., Morgan, G., Lan, Q., Smith, M.T., Spinelli, J.J., Willett, E., De Sanjose, S., Cocco, P., Berndt, S.I., Brennan, P., Brooks-Wilson, A., Wacholder, S., Becker, N., Hartge, P., Zheng, T., Roman, E., Holly, E.A., Boffetta, P., Armstrong, B., Cozen, W., Linet, M., Bosch, F.X., Ennas, M.G., Holford, T.R., Gallagher, R.P., Rollinson, S., Bracci, P.M., Cerhan, J.R., Whitby, D., Moore, P.S., Leaderer, B., Lai, A., Spink, C., Davis, S., Bosch, R., Scarpa, A., Zhang, Y., Severson, R.K., Yeager, M., Chanock, S. & Nieters, A. (2006) Genetic variation in TNF and IL10 and risk of non-Hodgkin lymphoma: a report from the InterLymph Consortium. The Lancet Oncology, 7, 2738. Skibola, C.F., Forrest, M.S., Coppede, F., Agana, L., Hubbard, A., Smith, M.T., Bracci, P.M. & Holly, E.A. (2004) Polymorphisms and haplotypes in folate-metabolizing genes and risk of non-Hodgkin lymphoma. Blood, 104, 21552162. Willett, E.V., Smith, A.G., Dovey, G.J., Morgan, G.J., Parker, J. & Roman, E. (2004) Tobacco and alcohol consumption and the risk of non-Hodgkin lymphoma. Cancer Causes and Control, 15, 771780. Yamada, R. & Ymamoto, K. (2005) Recent findings on genes associated with inflammatory disease. Mutation Research, 573, 136151. Supplementary material The following supplementary material is available for this article online: Table S1. Innate immunity genotype frequencies, odds ratios (OR), and 95% confidence intervals (CI) in non-Hodgkin lymphoma (NHL) casecontrol populations from the San Francisco Bay Area (SF) and United Kingdom (UK) using homozygous wild types as the reference. This material is available as part of the online article from http://www.blackwell-synergy.com Journal Compilation 2006 Blackwell Publishing Ltd No claim to original US government works British Journal of Haematology, 134, 180183 183