Document O3LEEzR6RYe65XQE0Dj0YxXw1

P- 1 Faft/ Taft Stettinius & Hollister LLP 425 W alnut Street, Suite 1 8 0 0 /Cincinnati, OH 45202-3957/Tel: 513.381.2838/Fax: 513.381.0205/www.taftlaw.com Cincinnati / Cleveland / Columbus/ Dayton / Indianapolis / Northern Kentucky/ Phoenix / Beijing Robert a . Bilott 513-357-9638 bilott@taftlaw.coir) August 31,2010 EPA Docket Center, MC 2822T U.S. Environmental Protection Agency EPA W est, Room 3334 1200 Pennsylvania Avenue, NW W ashington, D.C. 20460-0001 Re: Submission to IRIS and AR-226 Database For PFOA/PFOS: EPA-HQORD-2003-0016 To IRIS Database for PFOA/PFOS: In response to the Notice issued by USEPA on February 23, 2006, regarding USEPA's efforts to consider perfluorooctanoic acid ("PFOA") and perfluorooctane sulfonate ("PFOS") within the Integrated Risk Information System ("IRIS"), 71 Fed. Reg. 9333-9336 (Feb. 23, 2006), we are submitting the following additional information to USEPA fo r inclusion in that review, and fo r inclusion in the AR-226 database: 1. Minnesota Department of Health, "Public Health Assessment: Perfluorochemical Contamination in Southern Washington County, Northern Dakota County, and Southeast Ramsey County, Minnesota," (public comment release draft) (August 25, 2010); and 2. Kraugerud, M ,, et al, "Pefluorinated Compounds Differentially Affect Steroidogenesis in the Human Adrenocortical Carcinoma (H295R) inVitro Cell Assay, " (doctoral thesis manuscript) (August 2010). RAB:mdm Enclosure 11892885.1 Robert A. Bilott CONTAINS NO CBl August 3 1 ,2010 Page 2 cc: Gloria Post (NJDEP)(w/ end.) (via U.S. Mail) Helen Goeden (MDH)(w/ end.) (via U.S. Mail) Lora W erner (ATSDR)(w/ end.) (via U.S. Mail) {W1405808.1} Perfluorinated compounds differentially affect steroidogenesis in the human adrenocortical carcinoma (H295R) in vitro cell assay. Marianne Kraugerud"*, Karin E. Zimmerb, Erik Ropstad"., Steven Verhaegen* "Department of Production Animal Sciences, Norwegian School o f Veterinary Science, Postboks 8146 Dep, 0033 Oslo, Norway bDepartment of Basic Sciences and Aquatic Medicine, Norwegian School of Veterinary Science, Postboks 8146 Dep, 0033 Oslo, Norway *A11 correspondence to: Marianne Kraugerud Phone: +47 22597049 F a x : +4722597081 Email: Marianne.Kraugerud@veths.no Key words: perfluorooctane sulfonate; perfluorooctanoic acid; perfluorononanoic acid; steroidogenesis; endocrine disruption; H295R Acknowledgements This work was supported by the Research Council of Norway (158849/110 and 175098/V40). The authors would like to thank Ellen Dahl, Kristine von Krogh and Camilla AlmSs for excellent technical assistance. S. V. would like to thank Dr. Christine Nelleman and Dr. Anders Elleby Engel-Kofoed at the National Food Institute, Denmark, for the chance of visiting their lab and for assisting us in establishing and standardizing the H295R steroidogenesis assay. Manuscript 1 Abstract Perfluorinaled compounds (PFCs) are man-made chemicals which are present throughout the ecosystem, raising concerns about potential harmful effects of PFCs on humans and the environment. In order to investigate the effects of PFCs on steroid hormone production, human adrenocortical H295R cells were exposed to three PFCs including perfluorooctane sulfonate (PFOS), perfluorooctanoic acid (PFOA) and perfluorononanoic acid (PFNA) at six different concentrations (6 nM to 600 pM) for 48 hours. Oestradiol, progesterone, testosterone and cortisol were measured in the cell medium using radioimmunoassays. In addition, gene expression of 14 genes encoding proteins involved in steroidogenesis was measured using qRT-PCR. Exposure to PFOS resulted in an increase in oestradiol, progesterone and testosterone secretion at 600 pM. Furthermore, testosterone was elevated at 6 pM and 600 nM of PFOA and reduced at 60 pM PFNA. Gene expression of CYP1 A was decreased by all exposure doses of PFOA, whereas HMGR was decreased by 60 nM PFNA. We conclude that all PFCs tested are capable of altering steroidogenesis in the H295R in vitro model. The greatest effects were seen with PFOS exposure at the highest dose tested. The alterations in hormone secretion caused by PFOS appeared to be mediated by mechanisms other than changes in gene expression o f steroidogenic enzymes. 2 Manuscript Introduction Perfluorinated compounds (PFCs) arc man-made chemicals used as ingredients in a wide variety of applications including stain repellents and lubricants as well as in the production of fluoropolymers used in non-stick cookware. Due to their widespread use, PFCs are now detectable throughout all compartments of the ecosystem including air, water, sediments, animals and humans (Fromme et al., 2009; Nakata et al., 2006; Yamashita et al., 2005) even in remote places such as the arctic (AMAP, 2009). Recently, much attention has been directed towards the potential harmful effects on humans and the environment associated with the long-term exposure to PFCs. As a result, the United Nations Environment Programme (UNEP) made the decision to list the PFC perfluorooctane sulfonate (PFOS) and its salts as persistent organic pollutants (POPs) at the Stockholm Convention in Geneva, May, 2009. PFCs consist o f a fully fluorinated straight carbon backbone o f typically 4-14 carbons. attached to a charged functional moiety, giving rise to a large variety o f molecules (Figure 1). Due to the stability of the C-F bond, PFCs are slowly degradable, and human half-lives as long as 5.4 years and 3.8 years for PFOS and perfluorooctanoic acid (PFOA), two of the most abundant PFCs, have been reported (Olsen et al., 2007). Although the evidence of adverse effects of PFCs in human epidemiological studies has been a subject of debate, some studies have found that increasing human plasma PFCs are correlated with a lower birth weight (Apelberg et al., 2007; Fei et al., 2008). Furthermore, studies on laboratory animals suggest that PFCs increases the risk of stillbirth, decreases foetal weight and causes developmental defects (Case et al., 2001; Lau et al., 2003; Thibodeaux et al., 2003). This is of great concern, particularly considering that clearance rates of PFCs are much higher in some of the laboratory species than in humans. For example, in female rats half-lives of 0.08 and 2.44 days for PFOA and perfluorononanoic acid (PFNA), respectively, have been reported (Ohmori et al., 2003). It is also becoming increasingly recognized that PFCs can act as endocrine disruptors. Several in vivo studies typically report decreased plasma levels o f testosterone and the thyroid hormone thyroxin, in addition to an increase in oestradiol and cortisol following exposure to PFCs including PFOS and PFOA (Biegel et al., 1995; Biegel et al., 2001; Lau et al., 2003; Oakes et al., 2004; Thibodeaux et al., 2003). Studies have also identified a weak carcinogenic Manuscript 3 effect o f PFOA, manifested by an increased incidence of hepatic and Leydig cell adenomas in rats (Biegel et al., 1995; Biegel et a!., 2001). Whereas the hepatic tumour induction is mediated though peroxisome proliferator receptor (PPAR) binding, it is postulated that the neoplastic transformation of Leydig cells are caused, at least partially, by elevated oestradiol levels (Biegel et al., 2001). This is of great concern due to the possible link between oestrogenic effects of environmental pollution and the increased prevalence of human testicular cancer (Skakkebaek et al., 2001). To date, little research has focussed on the steroidogenesis pathway as a potential target for PFCs. Furthermore, previous studies have invariably been carried out on tissues and cell cultures o f animal origin. Considering the great differences in response to PFCs and their elimination between some species, it is evident that inter-species extrapolation of these results would be inaccurate. The human adrenocortical cell line, H295R, shows characteristics o f an undifferentiated foetal adrenal cortex and is capable of full steroidogenesis (Gazdaret al., 1990; Skakkebaek et al., 2001). Furthermore, it has been employed as an in vitro model for studying endocrine disruptors and it is currently being evaluated by the US-EPA and OECD as a Tier 1 screening assay for effects on steroidogenesis. The aim o f this study was to investigate how three structurally different PFCs commonly found in environmental samples affect steroidogenesis in the human H295R in vitro cell model. The compounds include the eight carbon chain molecules PFOS and PFOA in addition to the nine carbon chain molecule PFNA. Materials and methods Chemicals Tetrabuty[ammonium heptadecafluorooctanesulfonate, perfluorooctanoic acid and perflouorononanoic acid were purchased in powder form from Sigma-Aldrich (St Louis, MO, 4 Manuscript USA) with a purity o f >95%, >90% and >97% respectively. Chemicals were dissolved in dimethyl sulfoxide (DMSO) to 600 mM stock solutions and stored in aliquots at -20C. H295R cell culture The H295R cell line was obtained from the American Type Culture Collection (ATCC CRL2128, ATCC, Manassas, VA, USA) and cultured in 75cm2 flasks in Dulbecco's modified Eagle medium/HamF12 (DMEM/F12) containing HEPES buffer, L-glutamine and pyridoxine HCI (Gibco, Invitrogen, Paisley, UK). The medium was further supplemented with 1% ITS + premix and 2.5% NuSerum (BD Biosciences, Bedford, MA). Cells were incubated at 37C with 5% CO2 in a humidified atmosphere. Medium was changed every 2-3 days and cells passaged at approximately 80% confluence by a brief exposure to 0.25% trypsin/0.53 mM EDTA (Gibco, Invitrogen, Paisley, UK) followed by centrifugation and reseeding. The cells were used between passages 5-13. Exposure studies For experiments, cells were seeded at 3 x 105 cells/well in 24-well cell culture plates (Falcon, Franklin Lakes, NJ, USA). Ceils were incubated 24 hours prior to exposure to the compounds. H295R cells were exposed for 48 hours to six concentrations (6 nM, 60 nM, 600nM, 6 pM, 60 pM or 600 pM) of PFOS, PFOA or PFNA of in triplicates. Each plate also contained triplicate wells o f 600 pM tetrabutylammoniumchloride dissolved in DMSO (PFOS) or 0.1% DMSO (PFOA and PFNA) as solvent control and 10 pM forskolin as positive control. Forskolin stimulates cyclic AMP (cAMP) production in H295R cells and has similar effects to adrenocortiotrophic hormone (ACTH), the physiological stimulant o f adrenocortical steroidogenesis (Gracia et al., 2006). The experiment was conducted independently three times for hormone analysis and cell viability assay, and five times for qRT-PCR. Cell viability assay Cell viability was estimated using Alamar blue assay. At the end of exposure, medium was collected and stored at -20C for subsequent hormone analysis. Each well received 1 ml fresh medium containing 10% AlamarBlue (Invitrogen, Carlsbad, CA). Plates were incubated for a Manuscript 5 further 3 hours, then a 100 pi sample from each well was transferred in duplicates to a fresh 96-well ELISA plate (Falcon, Franklin Lakes, NJ, USA) and read in a Victor3TM spectrophotometer (Perkin Elmer, Shelton, USA) at 570 nm and 600 nm. Viability was expressed as percentage of solvent control. Radioimmunoassay Oestradiol-17f}, testosterone and cortisol secreted in the cell culture medium were measured using Coat-a-count radioimmunoassay (RIA) kits (Siemens, CA, LA, USA). Progesterone was measured using Spectria Progesterone RIA kit (Orion Diagnostica, Espoo, Finland). All kits were used according to manufacturer's instructions. The only modification was the use of fresh standard solutions prepared in medium from same batch as the cell cultures, rather than the supplied standards. The limits of detection were 20 pg/ml, 0.8 ng/ml, 0.10 ng/ml and 3.0 ng/ml and inter-assay coefficients of variation were 6.3%, 9.5%, 8.85% and 8.55% for oestradiol, progesterone, testosterone and cortisol respectively. RNA preparation Total RNA was isolated from cell culture plates using Qiagen RNeasy mini-kit (Qiagen, Crawley, UK) according to manufacturer's recommendations. Lysis buffer was added to wells and cells detached by scraping the bottom o f the well with the pipette tip. Prior to RNA extraction, cell lysates were then centrifuged through Qiagen shredder spin columns (Qiagen, Crawley, UK). Samples were treated with DNase (RNase-Free DNase Set, Qiagen, Crawley, UK) on-column for 15 min at room temperature. After isolation, samples were eluded in RNase-free H2O and stored at -70C. RNA concentration and quality was determined using NanoDrop (Thermo-Scientific, Waltham, MA, USA) and Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) respectively. Quantitative RT-PCR GeNorm human detection kit and software (PrimerDesign Ltd, Southampton, UK) was used to predict the most stable reference genes. Out of the five genes tested {B2M. fi-actin, YWHAZ, ATP5B, CAPDff), YWHAZ and ATP5B were the most stable were thus selected as reference genes in this study. 6 Manuscript Primer sequences for CYPHA, CYPI1B2. CYP17. CYPI9. CYP21. 3pHSD2, 170HSDI. 17/1HSD4, StAR and HMGR were obtained from (Hilscherova et al., 2004). Primers for CYPU Bl were designed by PrimerDesign Ltd (Southampton, UK). Primer sequences for SF/, DAX-1 End ACTH-R were designed in house using PrimerExpress version 1.5 (Applied Biosystems, Foster City, CA, USA) (Table 1). Specificities for all primer pairs were checked using nucIeotideBLAST and primerBLAST 0mn:/7blast.ncbi.nlm.nih.gov/Blast.eaif. All primers were used in a working concentration of 200 nM. The primers were tested with regard to annealing temperature. PCR products were analysed on an ethidium bromide agarose gel to ensure the expected product was formed and to check for potential primer artefacts. Synthesis o f cDNA and quantitative PCR was performed using Superscript Platinum in TwoStep qRT-PCR with SYBR Green (Invitrogen, Paisley, UK) according to manufacturer's instructions. The cDNA synthesis was performed using a Peltier Thermal Cycler-225 (MJResearch, Waltham, MA, USA) and qRT-PCR was carried out using a DNA Engine Thermal Cycler with Chromo 4 Real-Time Detector (MJResearch, Waltham, MA, USA) and its software, Opticon Monitor 3, (Bio-Rad Laboratories, Hercules, CA, USA). In the reverse transcription reaction (cDNA synthesis), RNA samples were split into technical triplicates. A negative control that had not been subjected to reverse transcriptase enzyme was added per sample to ensure no DNA contamination of the RNA sample. Furthermore, a negative control where no template was added prior to cDNA synthesis was included for each primer pair to check for primer dimer formations and contamination. The amount o f cDNA added to the qPCR reaction was 10 ng calculated from the original RNA concentration. Cycling conditions were 50C, 2 min (UDG incubation), 95C, 2 min (enzyme activation), followed by 40 cycles o f 95C in 15 sec, 62C in 30 sec and 72C in 30 sec. At the end of each run a melting curve from 65 - 90C, read for 1 sec every 0.3C, was included to monitor potential formation of primer dimers or products from genomic DNA and other DNA contamination. Negative controls without template and without RT enzyme were also monitored for any products formed during the qPCR reaction. qPCR data analysis Data was transferred from Opticon Monitor 3 software into an Excel spreadsheet for further processing. The ACt was calculated from the difference in expression between the gene of Manuscript 7 interest and the mean expression of the two reference genes. The AACt was calculated from the difference in ACt between cells exposed to solvent control and the chemical of interest. Fold change was calculated using 2 '^ . Statistical analysis Statistical analysis was performed using JMP software (SAS Institute Inc, Cary, NC, USA). The distribution of data was tested using the Shapiro-Wilk test Oestradiol data was not normally distributed and was therefore log transformed prior to analysis. Cortisol, progesterone and testosterone had a satisfactory fit to the normal distribution and were used without log transformation. Differences in hormone secretion between solvent control and exposed cells were evaluated using Student's t-test. Dose-response relationships were assessed in General Linear Models (GLM) where measured hormone concentrations were included as dependent variables and experiment (n = 3) and dose of the relevant test compounds were entered as continuous variables. The hormone data from the highest exposure doses o f PFOA and PFNA (600 pM) were excluded from statistical analyses due to cytotoxic effects on the cell viability assay. Differences in gene expression were evaluated by the Student's t-test by comparing the log2 transformed 2'A4Cl value of each exposure to solvent control. P values < 0.05 were considered statistically significant. Results Cell viability assay Cell viability as assessed by Alamar blue conversion indicated a viability of > 90% in all tested doses o f PFOS. Exposure to PFOA or PFNA at 600pM resulted in a dramatic decrease in viability, whereas cells exposed to the other doses o f these two compounds had a viability of > 90% (Figure 2). Hormone analyses All three test compounds affected hormone production in H295R cells (Figure 3). Oestradiol levels followed a significantly positive dose-response relationship when cells were exposed to 8 Manuscript PFOS. In addition, oestradiol was significantly elevated with the highest test dose (600 pM) o f PFOS. PFNA exposure between 0 and 60 pM also resulted in a significantly positive doseresponse relationship on oestradiol. At 60 pM exposure, PFNA gave a numerically higher, though not statistically significant, concentration of oestradiol. Cells treated with PFOA did not show any significant differences in oestradiol secretion to cells treated with solvent control. A positive dose-response relationship between progesterone and PFOS exposure was identified. Furthermore, the highest dose o f PFOS (600 pM) resulted in a significant increase in progesterone compared to solvent control. Although PFOA and PFNA exposure also resulted in a positive dose-response relationship on progesterone, no significant differences were seen when each dose was compared to the solvent control. Testosterone levels were influenced by all three compounds. Cells exposed to PFOS showed a significantly positive relationship between testosterone concentration and increasing level of exposure. When comparing each dose to control, exposure to PFOS only increased testosterone in the highest concentration of the test compound, whereas testosterone was elevated by 6 pM and 600 nM of PFOA. In contrast, PFNA exposure led to a significant negative dose-response relationship on testosterone. Additionally, the highest non cytotoxic dose of PFNA (60 pM) resulted in a significant reduction of testosterone. Cortisol was not significantly altered by exposure to PFOS and PFOA, although a negative dose-response relationship was identified with exposure to PFNA. Gene expression Only PFOA and PFNA induced changes in gene expression in the current study (Figure 4). All three test doses of PFOA decreased CYP11A levels. The other two test compounds did not affect mRNA levels of CYP11A. PFNA, however, significantly reduced HMGR expression, although only at 60 pM. The expression o f the other genes tested was not significantly altered by exposure to the test compounds. Manuscript 9 Discussion In the current study we demonstrated that PFOS, PFOA and PFNA have the capability to modulate steroidogenesis in the human adrenocortical H295R cell assay. Whereas an increase in oestradiol was observed with the highest test dose (600 pM) of PFOS, the PFOA and PFNA exposure at the same concentration gave a sharp decrease of all hormones measured due to cytotoxicity. At the second highest dose level tested (60 pM) the oestradiol level appeared increased with PFNA exposure, however this was not statistically significant. Oestradiol was not altered by PFOA. In contrast, some previous in vitro studies on rat Leydig cells have reported a characteristic increase in oestradiol secretion induced by 10 pM to 500 pM PFOA (Biegel et al., 1995; Liu et al., 1996). In addition, elevated plasma oestradiol levels following PFOA exposure in rats has been detected (Cook et al., 1992). Previous investigations of the ability of other fluorochemicals, such as PFOS, to elevate oestradiol is limited to one in vivo report where PFOS increases serum oestradiol secretion in fathead minnows (Pimephales promelas), however the response appeared not to be dosedependent and the results are therefore difficult to interpret (Oakes et al., 2005). Our findings, however, suggest oestradiol secretion can also be increased by PFOS. A possible explanation for the lack of response in oestradiol production with PFOA exposure in the current study could be the narrow response range limited by cytotoxicity in this particular in vitro model. Interestingly, we observed no significant changes in mRNA levels of CYP 19, the gene encoding the P450 aromatase enzyme responsible for conversion of testosterone to oestradiol, with exposure to any of the test chemicals. Hence, the PFOS-induced increase in oestradiol levels could be a result of a different mechanism than control o f gene expression. In the current study, the exposure compounds affected medium testosterone concentration in different patterns. Whereas PFNA decreased testosterone, PFOS and PFOA exposure led to an increase in testosterone. Previous studies on rats have demonstrated a non significant negative dose response relationship between PFOA and testosterone, which became significant when rats were challenged by bCG (Biegel et al., 2001). A similar response was seen by exposure to 500 or 50 jiM PFOA in Leydig cells where testosterone levels were normal in the absence of hCG and dramatically reduced when hCG was present (Biegel et al., 1995; Liu et al., 1996). Although immature rainbow trout (Oncorhynchus mykiss) had an 10 Manuscript elevated plasma testosterone following PFOS exposure, this was not seen in other fish species (Oakes et al., 2005). The increase in testosterone in vitro with the highest dose o f PFOS observed in this study has, to the best of our knowledge, not been previously reported. Perfluorinated compounds have previously been suggested to interfere with fatty acid metabolism and lipid transport in the livers of rare minnows (Gobiocypris rarus) (Wei et al., 2008) and appear to inhibit the transport of cholesterol into the mitochondria in rat Leydig cell cultures (Boujrad et al., 2000). However, such effects would lead to a reduced steroidogenesis due to a lack of substrate and could therefore not explain the elevated testosterone observed in the current study. A significantly elevated progesterone, in addition to oestradiol and testosterone suggest that PFOS could affect the steroid synthesis upstream of progesterone in our study. In the current study, no significant effect on cortisol production was observed by any of the three test compounds. Little research has been attributed to the effect of PFCs on cortisol production. Two studies in which mice were exposed to PFNA, reported increased plasma cortisol levels (Fang et al., 2008; Fang et al., 2009). In one of these studies, an elevated level o f ACTH was also found, suggesting that PFCs may affect cortisol production upstream of the adrenal gland in the hypothalamic-pituitary-adrenal axis. This could explain the lack of effects on cortisol synthesis observed in our study. In summary, PFCs including PFOS, PFOA and PFNA are capable of modulating steroid secretion in human adrenocortical H295R cells. Oestradiol, progesterone and testosterone was elevated by the highest dose (600 pM) of PFOS. PFOA and PFNA did not significantly alter oestradiol and progesterone secretion; however, testosterone was increased by PFOA and decreased by PFNA. Only PFOA and PFNA induced changes in gene expression resulting from up regulation CYP11A and HMGR respectively. We therefore propose that the changes in hormone secretion by PFOS are mediated by mechanisms other than modulation of gene expression of the steroidogenic enzymes investigated. Conflict of Interest Statement The authors declare that there are no conflicts of interest. Manuscript II References AMAP, 2009. Arctic Pollution 2009. Arctic Monitoring and Assessment Programme, Oslo. xi+83pp. Apelberg, B.J., Witter, F.R., Herbstman, J.B., Calafat, A.M., Halden, R.U., Needham, L.L., Goldman, L.R., 2007. Cord serum concentrations of perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) in relation to weight and size at birth. Environ. Health Perspect. 115, 1670-1676. Biegel, L.B., Hurtt, M.E., Frame, S.R., O'Connor, J.C., Cook, J.C., 2001. Mechanisms of extrahepatic tumor induction by peroxisome proliferators in male CD rats. Toxicol. Sei. 60,44-55. Biegel, L.B., Liu, R.C., Hurtt, M.E., Cook, J.C., 1995. Effects of ammonium perfluorooctanoate on Leydig cell function: in vitro, in vivo, and ex vivo studies. Toxicol. Appl. Pharmacol. 134, 18-25. Boujrad, N., Vidic, B., Gazouli, M., Culty, M., Papadopoulos, V,, 2000. The peroxisome proliferator perfluorodecanoic acid inhibits the peripheral-type benzodiazepine receptor (PBR) expression and hormone-stimulated mitochondrial cholesterol transport and steroid formation in Leydig cells. Endocrinology 141, 3137-3148. Case, M.T., York, R.G., Christian, M.S., 2001. Rat and rabbit oral developmental toxicology studies with two perfluorinated compounds. Int. J. Toxicol. 20, 101-109. Cook, J.C., Murray, S.M., Frame, S.R., Hurtt, M.E., 1992. Induction of Leydig cell adenomas by ammonium perfluorooctanoate: a possible endocrine-related mechanism. Toxicol. Appl. Pharmacol. 113,209-217. Fang, X., Feng, Y,, Shi, Z., Dai, J., 2009. Alterations of cytokines and MAPK signaling pathways are related to the immunotoxic effect of perfluorononanoic acid. Toxicol. Sci. 108,367-376. Fang, X., Zhang, L., Feng, Y., Zhao, Y., Dai, J., 2008. Immunotoxic effects of perfluorononanoic acid on BALB/c mice. Toxicol. Sci. 105,312-321. Fei, C., McLaughlin, J.K., Tarone, R.E., Olsen, J., 2008. Fetal growth indicators and perfluorinated chemicals: a study in the Danish National Birth Cohort. Am. J. Epidemiol. 168,66-72. Fromme, H., Tittlemier, S.A., Volkel, W., Wilhelm, M., Twardella, D., 2009. Perfluorinated compounds--exposure assessment for the general population in Western countries. Int. J. Hyg. Environ. Health 212, 239-270. Gazdar, A.F., Oie, H.K., Shackleton, C.H., Chen, T.R., Triche, T.J., Myers, C.E., Chrousos, G.P., Brennan, M.F., Stein, C.A., La Rocca, R.V., 1990. Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res. 50, 5488-5496. 12 Manuscript Gracia, T., Hilscherova, K., Jones, P.D., Newsted, J.L., Zhang, X., Hecker, M., Higley, E.B., Sanderson, J.T., Yu, R.M., Wu, R.S., Giesy, J.P., 2006. The H295R system for evaluation of endocrine-disrupting effects. Ecotoxicol. Environ. Saf 65, 293-305. Hilscherova, K., Jones, P.D., Gracia, T., Newsted, J.L., Zhang, X., Sanderson, J.T., Yu, R.M., Wu, R.S., Giesy, J.P., 2004. Assessment of the effects o f chemicals on the expression of ten steroidogenic genes in the H295R cell line using real-time PCR. Toxicol. Sci. 81,78-89. Lau, C., Thibodeaux, J.R., Hanson, R.G., Rogers, J.M., Grey, B.E., Stanton, M.E., Butenhoff, J.L., Stevenson, L.A., 2003. Exposure to perfluorooctane sulfonate during pregnancy in rat and mouse. [I: postnatal evaluation. Toxicol. Sci. 74, 382-392. Liu, R.C., Hahn, C., Hurtt, M.E., 1996. The direct effect o f hepatic peroxisome proliferators on rat Leydig celt function in vitro. Fundam. Appl. Toxicol. 30, 102-108. Nakata, H., Kannan, K., Nasu, T., Cho, H.S., Sinclair, E., Takemurai, A., 2006. Perfluorinated contaminants in sediments and aquatic organisms collected from shallow water and tidal flat areas of the Ariake Sea, Japan: environmental fate of perfluorooctane sulfonate in aquatic ecosystems. Environ. Sci. Technol. 40,4916-4921. Oakes, K.D., Sibley, P.K., Martin, J.W., MacLean, D.D., Solomon, K.R., Mabury, S.A., Van Der Kraak, G.J., 2005. Short-term exposures of fish to perfluorooctane sulfonate: acute effects on fatty acyl-coa oxidase activity, oxidative stress, and circulating sex steroids. Environ. Toxicol. Chem. 24, 1172-1181. Oakes, K.D., Sibley, P.K., Solomon, K.R., Mabury, S.A., Van Der Kraak, G.J., 2004. Impact of perfluorooctanoic acid on fathead minnow (Pimephales promelas) fatty acyl-CoA oxidase activity, circulating steroids, and reproduction in outdoor microcosms. Environ. Toxicol. Chem. 23,1912-1919. Ohmori, K., Kudo, N., Katayama, K., Kawashima, Y., 2003. Comparison o f the toxicokinetics between perfluorocarboxylic acids with different carbon chain length. Toxicology 184,135-140. Olsen, G.W., Burris, J.M., Ehresman, D.J., Froehlich, J.W., Seacat, A.M., Butenhoff, J.L., Zobel, L.R., 2007. Half-life of serum elimination of perfluorooctanesu1fonate,periluorohexanesuIfonate, and perfluorooctanoate in retired fluorochemical production workers. Environ. Health Perspect. 115, 1298-1305. Skakkebaek, N.E., Rajpert-De, M.E., Main, K.M., 2001. Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects. Hum. Reprod. 16, 972-978. Thibodeaux, J.R., Hanson, R.G., Rogers, J.M., Grey, B.E., Barbee, B.D.', Richards, J.H., Butenhoff, J.L., Stevenson, L.A., Lau, C., 2003. Exposure to perfluorooctane sulfonate during pregnancy in rat and mouse. I: maternal and prenatal evaluations. Toxicol. Sci. 74,369-381. Wei, Y,, Liu, Y., Wang, J,, Tao, Y., Dai, J., 2008. Toxicogenomic analysis of the hepatic effects of perfluorooctanoic acid on rare minnows (Gobiocypris rarus). Toxicol. Appl. Pharmacol. 226,285-297. Manuscript 13 Yamashita, N., Kannan, K., Taniyasu, S., Horii, Y., Petrick, G., Gamo, T., 2005. A global survey of perfluorinated acids in ocans. Mar. Pollut. Bull. 51, 658-668. 14 Manuscript Figure 1: Skeletal formulas o f the PFOS (A), PFOA (B) and PFNA (C) molecules. Figure 2: Mean (SE) cell viability of H295R cells assessed with Alamar blue assay for each concentration of PFOS, PFOA and PFNA expressed as % o f solvent control. Figure 3: Mean (SE) concentrations of steroid hormones measured in medium of H295R cells after 48 hour exposure to six concentrations of PFCs. * denotes means significantly different from solvent control (P < 0.05) t denotes cell viability < 90%. Figure 4: Mean (SE) fold change in gene expression of CYP11A and HMGR following 48 hour exposure to three concentrations of PFCs - * denotes significantly different from solvent control (P < 0.05). Figure 1. A F R F F. F F F SO,H FFFFFFFF B F FF FF F O FFFFFFFF Figure 2. p. 19 PFOS 0 PFOA PFNA % of solvent control exposure ng/ml progesterone CD Wri009 Wrt09 Wflg Wri9`0 Wri90`0 wrlgoo'O INriO > pg/ml oestradiol o Ool oo g ohoo ro ou \ ooCO GJ U1 O oo (TCO <6 p. 20 Iw HH)9 INriog W^9 mrig`0 wrigo`0 wrtgoo`0 W^O o O ng/ml testosterone -A IS 0 3 * U l IS3 O Ca> l p. 21 0.51 0 Fold change \jU o OO 0 M>)CO-` Wi Fold change o oP io PP - > ho *> "I 1 SA s 23 ccf3" -I W^SOD'O Wri9` 0 Ifl|ri09 DPI "-n0 **0n T-nJ * >Z O> Oco p. 22 Table 1: Primer sequences used for quantitaive RT-PCR. Primer sequenses for CYP11A, CYPHB2, CYP17, CYPI9, CYP2I, 3bHSD2. ! 7bHSDJ, 17bHSD4, StAR and HMGR are given in Hilscherova et al. (2004). CYPI1BI was designed by PrimerDesign Ltd. G ene ab b rev iatio n G ene nam e G ene product ab b rev iatio n G ene p ro d u c t F o rw ard p rin ter R everse p rim er N R SA 1 N u clear recep to r subfam ily $ group A, m em ber 1 SF-1 S te r o i d o g e n i c f a c t o r -1 TGGAGCTGACCa Ca GTGGC g g a a cttc a a a tcca g g ctg a a NROBI N u clear recep to r subfam ily 0 group B, m em ber 1 D A X -I D osage-sensitive sex reversal, adrenal h y p o p lasia critical region, on chrom osom e X, gene 1 CTCTTTAACCCGGACGTGCC GCTGCGTCATCCTGCTCTGT AC TH R A dren o co rtico tro p ic horm one receptor ACTHR A drenoeortkotrophic horm one receptor GGAGGCAAACACCACCTCATT CACTCTTCCATTGCTGGCATCT ATP5B A T P sy n th ase subunit beta, m itochondrial A T P synthase subunit beta, m itochondrial ACCATCAAAGGATTCCACCA GCTTTTCCCACAGCTTCTTC YW HAZ T yrosine 3m o n o oxygenase/tryptop han5*m onooxygcnase activ atio n protein, zeta p o ly p e p tid e 14-3*3 protein z e ta /d e lta T yrosine 3m onooxygenase/tryptoph an 5-m onooxygenase activation protein, zeta p o ly p e p tid e c c ca a tg c ttc a c a a g c a g a g CCTTTCTTGTCATCACCAGCC Public Health Assessment P u b lic C o m m e n t R ele ase PERFLOUROCHEMICAL CONTAMINATION IN SOUTHERN WASHINGTON COUNTY, NORTHERN DAKOTA COUNTY, AND SOUTHEAST RAMSEY COUNTY, MINNESOTA (Including: Woodbury, Cottage Grove, Newport, St. Paul Park, Afton, Grey Cloud Island Township, Denmark Township, South S t Paul, Hastings and Maplewood) EPA FACILITY ID: MND980679385 Prepared by Minnesota Department of Health August 25, 2010 COMMENT PERIOD ENDS: October 12, 2010 Prepared by Minnesota department of Health Under Cooperative Agreement with the .S. DEPARTMENT OF HEALTH AND HUMAN SERVICES Agency for Toxic Substances and Disease Registry Division of Health Assessment and Consultation Atlanta, Georgia 30333 THE ATSDR PUBLIC HEALTH ASSESSMENT: A NOTE OF EXPLANATION This Public Health Assessment-Public Comment Release was prepared by ATSDR pursuant to the Comprehensive Environmental-Response, Compensation, and Liability Act (CERCLA or Superfundt section 104 (i)(6) (42 U.S.C. 9604 (i)(6), and in accordance with our implementing regulations (42 C.F.R. Parr 90). In preparing this document, ATSDR's Cooperative Agreement Partner has collected relevant health data, environmental data, and community health concerns from the Environmental Protection Agency (EPA), state and local health and environmental agencies, the community, and potentially responsible parties, where appropriate. This document represents the agency's best efforts, based on currently available information, to fulfill the statutory criteria set out in CERCLA section 104 (i)(6) within a limited time frame, lo the extent possible, it presents an assessment of potential risks to human health. Actions authorized by CERCLA section 104 (i)(l 1), or otherwise authorized by CERCLA. may be undertaken to prevent or mitigate human exposure or risks to human health. In addition, ATSDR's Cooperative Agreement Partner will utilize this document to determine if follow-up health actions are appropriate at this time. This document has previously been provided to EPA and the affected state in an initial release, as required by CERCLA section 104 (i) (6) (H) for their information and review. Where necessaiy, it has been revised in response to comments or additional relevant information provided by them to ATSDR's Cooperative Agreement Partner. This revised document has now been released tor a 30-day public comment period. Subsequent to the public comment period, ATSDR's Cooperative Agreement Partner will address all public comments and revise or append the document as appropriate. The public health assessment will then be reissued. This will conclude the public health assessment process for this site, unless additional information is obtained by ATSDR's Cooperative Agreement Paitner which, in the agency's opinion, indicates a need to revise or append the conclusions previously issued. Use of trade names is for identification only and does not constitute endorsement by the U.S. Department of Health and Human Services. Please address comments regarding this report to: Agency for Toxic Substances and Disease Registry Attn: Records Center 1600 Clifton Road, N.E.. MS F-09 Atlanta, Georgia 30333 You May Contact ATSDR Toll Free at 1-800-CDC-INFO or Visit our Horne Page at: http://w-ww.atsdr.cdc.gov Perfluorochemical Contamination in Southern Washington County, Northern Dakota County and Southeastern Ramsey County, Minnesota Public Comment PUBLIC HEALTH ASSESSMENT PERFLUOROCHEMICAL CONTAMINATION IN SOUTHERN WASHINGTON COUNTY, NORTHERN DAKOTA COUNTY, AND SOUTHEASTERN RAMSEY COUNTY, MINNESOTA (Including: Woodbuiy, Cottage Grove, Newport, St. Paul Park, Afton, Grey Cloud Island Township, Denmark Township, South St. Paul, Hastings and Maplewood) EPA FACILITY ID: MND980679385 Prepared by: Minnesota Department o f Health Under Cooperative Agreement with the U.S. Department o f Health and Human Services Agency for Toxic Substances and Disease Registry This information is distributed by the Agencyfo r Toxic Substances and Disease Registryfor public comment under applicable information quality guidelines. It does not represent and should not be construed to representfinal agency conclusions or recommendations. FOREWORD This document summarizes public health concerns related to a waste disposal site in Minnesota, and is a formal site evaluation prepared by the Minnesota Department o f Health (MDH). For a formal site evaluation, a number o f steps are necessary: Evaluating exposure: MDH scientists begin by reviewing available information about environmental conditions at the site. The first task is to find out how much contamination is present, where it is found on the site, and how people might be exposed to it. Usually, MDH does not collect its own environmental sampling data (although this case is an exception). Rather, MDH relies on information provided by the Minnesota Pollution Control Agency (MPCA), the Minnesota Department o f Agriculture (MDA), the US Environmental Protection Agency (EPA), private businesses, and the general public. Evaluating health effects: If there is evidence that people are being exposed-- or could be exposed-- to environmental contaminants, MDH scientists will take steps to determine whether that exposure could be harmful to human health. MDH's report focuses on public health-- that is, the health impact on the community as a whole. The report is based on existing scientific information. Developing recommendations: In this report, MDH outlines conclusions regarding any potential health threat posed by a site and offers recommendations for reducing or eliminating human exposure to pollutants. The role o f MDH is primarily advisory. For that reason, the evaluation report will typically recommend actions to be taken by other agencies-- including EPA and MPCA. If, however, an immediate health threat exists, MDH will issue a public health advisory to warn people o f the danger and will work to resolve the problem. Soliciting community input: The evaluation process is interactive. MDH starts by soliciting and evaluating information from various government agencies, the individuals or organizations responsible for the site, and community members living near the site. Any conclusions about the site are shared with the individuals, groups, and organizations that provided the information. Once an evaluation report has been prepared, MDH seeks feedback from the public. Ifyou have questions or comments about this report, we encourage you to contact us. Please write to: Community Relations Coordinator Site Assessment and Consultation Unit Minnesota Department o f Health 625 North Robert Street / P.O. Box 64975 St. Paul, MN 55164-0975 OR call us at: (651) 201-4897 or 1-800-657-3908 (toll free call - press "4" on your touch tone phone) On the web: http://www.health.state.mn.us/divs/ehyhazardous/index.htinl 2 Table of Contents F O R E W O R D .................................................................................................................................. 2 Table o f Contents....................................................................................................................... 3 Summary..................................................................................................................................... 4 Introduction................ ................................................................................................................5 Background...................................... 7 3M-Woodbury Disposal Site Description and History.................................................... 7 Geology / Hydrogeology.......................................................................................................8 PFC Analysis......................................................................................................................11 Evaluation o f PFCs in Drinking Water...........................................................................11 Community Well Monitoring...................... ....................................................................12 Private Well Sampling...................................................................................................... 14 PFC-Related Investigations at the 3M-Woodbury Disposal S ite ...............................15 MPCA - 3M Consent Order for PFC Disposal Sites....................................................17 Remedial Options for the 3M-Woodbury Disposal Site.............................................. 18 Site V isits............................................................................................................................ 19 Demographics, Land Use, and Natural Resources........................................................ 20 General Regional Issues...................... ............................................................................. 21 Community Concerns....................................................................................................... 21 Evaluation o f Environmental Fate and Exposure Pathways...................... ..................... 21 Introduction..........................................................................................................................21 Environmental Fate............................................................................................................22 Evaluation o f Impacts on Groundwater..........................................................................23 Exposure through Private W ells...................................................................................... 27 Exposure through Public Water Supplies.......................................................................28 Exposure through other Pathways...................................................................................29 Public Health Implications o f PFC Exposure.....................................................................29 Summary o f Toxicological Information......................................................................... 30 Summary o f Human Exposure Information................................................................... 32 Discussion o f the Public Health Implications o f PFC Exposure................................ 34 Health Outcome Data R eview ......................................................................................... 35 Child Health Considerations................................................................................................. 36 Conclusions................................................................................................... ..........................36 Recommendations...................................................................................................................37 Public Health Action Plan..................................................................................................... 37 R eferences................................................................................................................................ 38 Preparers o f Report................................................................................................................ 47 CERTIFICATION.......................................................................................... ...........................48 Glossary................................................................................................................................... 49 Appendices Appendix 1: Figures Appendix 2: Tables 3 p. 29 Summary INTRODUCTION The Minnesota Department o f Health's (MDH) mission is to protect, maintain, and improve the health o f all Minnesotans. For communities affected by perfluorochemicals (PFCs) in their drinking water, MDH's goal is to protect people's health by providing health information the community needs to take actions to protect their health. MDH also monitors public water supplies for PFCs, and advises the MPCA on actions that can be taken to protect public health. PFC-containing wastes were disposed o f by 3M in land disposal sites in Oakdale, Lake Elmo, and Woodbury, Minnesota. PFCs were released to the groundwater from these sites, possibly shortly after the disposal occurred, resulting in contamination o f nearby drinking water wells. There were also possible air emissions during the handling, disposal, or burning o f waste, and people could have come into direct contact with the waste. PFCs continue to be detected in public and private wells across a wide area o f south Washington County, and in parts o f northern Dakota County and southeastern Ramsey County. OVERVIEW MDH reached two important conclusions in this Public Health Assessment. CONCLUSION 1 MDH cannot conclude whether drinking or breathing PFCs in water or air or contact with PFC-containing wastes in the past harmed people's health. BASIS FOR DECISION A pilot biomonitoring study conducted in residents o f Oakdale, Lake Elmo, and Cottage Grove indicated levels o f PFCs in blood above national averages. While available evidence suggests that these PFC levels are unlikely to cause adverse health effects, there is no information available regarding PFC levels in resident's blood or in drinking water in the past. NEXT STEPS MDH should consider additional biomonitoring studies to evaluate PFC levels in area residents exposed to PFOA and PFOS in drinking water. CONCLUSION 2 MDH concludes that currently, drinking water from public or private wells that contain PFCs is not expected to harm people's health. BASIS FOR DECISION Current exposures to PFCs are below health-based exposure limits because bottled water or whole-house activated carbon filters have been provided at 29 homes that were issued a drinking water well advisory by MDH. No one is drinking water that has PFCs at levels above health concern. Remediation actions to address PFCs at the waste disposal sites are in the early implementation stages by 3M and the MPCA._____________________________ 4 NEXT STEPS 3M should continue to follow the requirements o f the Consent Order to implement the selected remediation options for soil and groundwater at the 3M-Woodbury Disposal Site. People should avoid trespassing on the 3M-Woodbury Disposal Site, especially during remediation activities. Extensions o f the Cottage Grove municipal water supply to serve areas where private wells contain levels o f PFCs in excess o f MDH HRLs or HBVs should be considered. Monitoring o f selected private wells in the affected area should continue under agreed upon sampling plans to track changes in the plume and monitor for changes in concentration in individual wells. 3M should ensure the monitoring network at the disposal site provides adequate information regarding water quality in the "high transmissivity zone" o f the Prairie du Chien aquifer. FOR MORE INFORMATION if you have concerns about your health, you should contact your health care provider. You may also call MDH at 651-201-4897 or 1-800-657-3908 (press #4) and ask for information on PFCs. You may also visit our PFC Web site at http://www.health.state.mn.us/divs/eh/ha2ard0us/t0Dics/pfcs/index.html Introduction The 3M Company (3M; formerly Minnesota Mining and Manufacturing Company) began research and development o f perfluorochemicals (PFCs) at its Cottage Grove, Minnesota facility in southern Washington County, Minnesota in the late 1940s; with commercial production o f various PFC compounds occurring from the early 1950s until 2002. Production o f one PFC, perfluorobutanoic acid (PFBA) ceased in 1998. The production or use o f other PFC-related compounds in research or pilot scale projects continues today. MDH prepared a Health Consultation focusing on PFC releases at the Cottage Grove facility (MDH 2005). Wastes from the electrofluorochemical PFC production process, including production wastes and wastewater treatment plant sludge, were disposed o f at the Cottage Grove facility and several known disposal sites identified by 3M in Washington County (Weston 2005). The names o f these facilities, the types o f wastes disposed of, and the estimated time o f the disposal were formally provided to the Minnesota Pollution Control Agency (MPCA) by 3M in June o f 2005 and are listed below: 5 Disposal Facilities in Washington County that Received 3M PFC Wastes Disposal Facility Waste Disposed Estimated Dates 3M-Oakdale Disposal Site Liquid and solid industrial waste 1956-1960 3M-Woodbury Disposal Site Liquid and solid industrial waste 1960-1966 Washington County Landfill, Wastewater treatment plant sludge, 1971 -1 9 7 4 Lake Elmo incinerator scrubber sludge and ash, iron oxide sludge 3M-Cottage Grove Facility Industrial wastes, ash, sludge 1 9 5 0 s- 1970s Pigs Eye Dump, St. Paul* Incinerator scrubber sludge and ash I9 7 I (also received municipal waste water treatment plant incinerator ash which may have contained PFCs) *This site is actually in Ramsey Co., near the border with Washington Co. The general locations o f the above disposal sites, along with the 3M Cottage Grove facility are shown in Figure 1 (all figures can be found in Appendix l). A separate report was issued in August 2008 evaluating PFC waste disposial at the 3M-Oakdale Disposal Site and the Washington County Landfill in Lake Elmo and its potential impact on those communities (MDH 2008). An updated report on the 3M-Cottage Grove facility and PFC impacts to the Mississippi River is planned. The Pigs Eye Dump is included in the list because it was identified by 3M as a disposal site that received PFC-containing wastes; PFCs have been detected in groundwater and surface water at the site. It is not included in the Consent Order agreement between 3M and the MPCA (see below). Perfluorochemicals are a class o f organic chemicals in which fluorine atoms completely replace the hydrogen atoms that are typically attached to the carbon `backbone' o f organic hydrocarbon molecules (Figure 2). Because o f the very high strength o f the carbon-fluorine bond, PFCs are inherently stable, nonreactive, and resistant to degradation (3M 1999a). PFCs made by 3M at its Cottage Grove facility were used in the manufacture o f a variety o f commercial and industrial products by 3M and other companies, including fabric coatings (such as ScotchgardTM), surfactants, non-stick products (including TeflonTM), fire-fighting foams, film coatings, and other products. PFCs unique physical and chemical properties allow them to move easily through the environment (EPA 2002, OECD 2002, ATSDR 2009). As a result, they have been found globally at low levels. Some PFCs are bio-accumulative (i.e., build up in living organisms) and one PFC, perfluorooctane sulfonate (PFOS) has been detected in the blood and tissues o f humans and animals from virtually all parts o f the world. It should be noted that while the use o f PFCs has been restricted in the United States by the EPA to certain products for which there is no adequate substitute, they are still manufactured and used in other countries around the world, including Italy, Russia, China, Japan, and Korea. Toxicological research on PFCs is ongoing in government, industry and academia. Published studies show that animal exposure to PFCs at high concentrations adversely 6 p. 32 affects the liver and other organs (ATSDR 2009). The mechanisms o f toxicity are not entirely clear; one likely major mechanism involves effects on certain enzymes regulating metabolic pathways in the liver. Exposure to high concentrations o f one PFC, perfluorooctanoic acid (PFOA) over long durations has been shown to cause tumors in some test animals, although the specific mechanisms are not clear and the relevance to humans may be low. Developmental effects have also been observed in the offspring of pregnant rats and mice exposed to high doses o f PFOA and PFOS. PFCs disposed o f at the sites identified above have impacted soil, groundwater, surface water, sediments, biota, and nearby drinking water wells, both public and private. MDH has prepared this report in response to requests from the MPCA, Washington County, local communities, and citizens to: summarize current conditions in southern Washington County, northern Dakota County, and southeastern Ramsey County relative to the PFC contamination; evaluate the potential health risks associated with the use o f drinking water impacted by PFCs, especially in public water supplies; provide the public with an opportunity to comment on the public health actions taken to date; and provide recommendations to protect public health in the future. MDH has consulted with staff from the U.S. Environmental Protection Agency (EPA), MPCA, Washington County, the cities o f Woodbury, Cottage Grove, Hastings, St. Paul Park, and other local governments in the affected area, community members, and 3M to gather information for this report. Background 3M-Woodburv Disposal Site Description and History The 656-acre property that contains the 3M-Woodbury Disposal Site straddles the border o f Woodbury and Cottage Grove (see Figure 3). The actual waste disposal areas are located in Woodbury and consist o f two areas referred to as the Main Disposal Area (approximately ten acres) and the Northeast Disposal Area (approximately five acres; Weston 2007a). From I960 to 1966, private contractors operated the site for a short time, and then sold it to 3M who used the site to dispose o f liquid and solid industrial wastes (solvents, tapes, plastics, and resins) generated at their Cottage Grove facility. The wastes were buried in trenches. In addition, municipal wastes from the cities o f Woodbury and Cottage Grove were disposed of in two separate areas o f the site (approximately five acres total) from 1964-1966 (Weston 2008a). Groundwater contamination at the site was first detected in 1966 when volatile organic compounds (VOCs, mostly solvents) were found in groundwater monitoring wells on the site and a private well located immediately west o f the site. A groundwater extraction 7 system was completed at the site by 1973 and has operated continuously since. The extracted groundwater is pumped via a pipeline to the 3M Cottage Grove manufacturing plant, where it is used as cooling or process water and then discharged to the Mississippi River. Additional cleanup measures were taken at the site to consolidate and bum wastes, with the goal o f reducing sources o f VOC contamination to the groundwater. Approximately 200,000 cubic yards o f wastes were excavated from the Main Disposal Area and burned on-site in February o f 1968. The remaining ash and waste were consolidated and re buried in the Main Disposal Area trenches. In 1992, 3M entered the site into the MPCA's Voluntary Investigation and Cleanup (VIC) program, under which additional investigation and response actions were taken to further address contamination at the site. In 1996, 3M backfilled open areas and regraded the site, placed a cap consisting o f a minimum o f 24 inches o f clean soil over the former disposal areas, and filed an institutional control on the property deed to restrict future land use at the property. Geology / Hydrogeology The geology o f the region where the 3M-Woodbury Disposal Site is located consists of glacial drift and alluvial sediments (stratified sand, silt, and clay deposited by glaciers and rivers, respectively) overlying a thick sequence o f Paleozoic sedimentary rock formations made up o f sandstone, limestone, dolomite, and shale. These, in turn, overlay pre-Cambrian volcanic rock formations composed primarily o f basalt. The bedrock formations tilt and thicken slightly to the south and west, forming the eastern rim o f a large geologic structure known as the Twin Cities Basin. Figure 4 shows the sequence o f bedrock units in south Washington County. The geology o f this area has been extensively studied by the Minnesota Geological Survey and others (Tipping et al. 2006; Runkel et al. 2003; MGS 1990). Before the glacial drift and alluvial sediments were deposited, streams eroded deep valleys into the surface of the bedrock. In some places the valleys cut down to the Jordan Sandstone. The valleys were later filled with glacial and alluvial sediments, leaving little or no evidence at the surface o f their presence below, except for a series o f elongated lakes in Lake Elmo and a deep ravine in southern Cottage Grove. Figure 1 shows the location o f a major bedrock valley that extends from Lake Elmo south to the Mississippi River valley. The bedrock valleys in south Washington County provide pathways that allow contaminants in the groundwater to enter deeper aquifers more rapidly than would be the case if the bedrock layers were intact. The bedrock valley shown is present beneath the west side o f the site. As the valley was eroded, successively deeper bedrock formations were exposed from east to west. As a result, the uppermost bedrock layer in the northeastern portion o f the site is the Platteville Limestone, while in the center o f the site it is the St. Peter Sandstone, and on the west side it is the Prairie du Chien Group dolomite and Jordan Sandstone (see Figure 5). 8 The bedrock in southern Washington County also has been altered by major faults (fractures in the rock along which movement has occurred, see Figure 1). In sortie places, bedrock units on either side o f such faults have been displaced vertically as much as 150 feet. This means that in some parts o f the investigation area, one geologic formation may be in direct contact with another (see Figure 4). This may allow groundwater and contaminants to move between aquifers that might not otherwise be connected. It also means that two wells o f similar depth and separated by a distance o f only a few hundred feet may draw water from completely different formations. Regional groundwater flow in the area o f the site is further complicated by the presence o f two major regional groundwater discharge features, the Mississippi and St. Croix Rivers. In general, groundwater in the east half o f Washington County flows toward and discharges to the St. Croix River, while groundwater in the west half o f the county flows toward and discharges to the Mississippi River. The zone where this divergence o f the groundwater flow occurs is often referred to as a groundwater divide (Figure 1). While similar in concept to the better known "continental divide" (that separates rivers that flow east to the Atlantic Ocean from those that flow west to the Pacific Ocean), a groundwater divide is less fixed and may shift its location as a result in changes in climate and pumping o f groundwater. As a result, the location o f the actual groundwater divide is approximate, will change over time, and may be slightly different in each aquifer. In southern Washington County, the groundwater divide is located somewhere near or under the east side of the 3M-Woodbury Disposal Site. This means that groundwater contaminants beneath eastern portions o f the site could move east-southeast toward the St. Croix River while those beneath western portions o f the site would more likely move west-southwest toward the Mississippi River. Additionally, in Denmark Township and southeast Cottage Grove, near where the two rivers converge, the regional groundwater flow direction "fans out." The result is that groundwater contamination from the site could potentially affect a larger area than is typically seen at most sites. The type o f geologic units beneath the disposal site also affects how groundwater and contaminants move. The sand and gravel deposits in the buried bedrock valley, and the Platteville, St. Peter and Prairie du Chien formations beneath the site are highly permeable, allowing groundwater to easily move downward through pore spaces between sand grains and along fractures. There are four major drinking water aquifers in the investigation area, that are from shallowest to deepest: St. Peter Sandstone, Prairie du Chien Group, Jordan Sandstone, and Franconia Sandstone (Figure 4). State well records also indicate there are some wells using the overlying sand and gravel deposits, but this appears to be rare. All o f the municipal water supply wells in the affected communities draw water from the Jordan Sandstone. Groundwater in the St. Peter migrates primarily through the pore spaces between the sand grains, although fractures and solution cavities are present in the St. Peter, particularly near the buried bedrock valleys (Alexander 2007; Runkel et al, 2007). Such solution 9 cavities may create pathways through which groundwater and contaminants migrate more quickly than is typically observed in the St. Peter. Groundwater flow in the Prairie du Chien dolomite is heavily influenced by fractures (cracks and voids) in the formation. The Prairie du. Chien is actually considered a "group" composed o f two separate dolomite formations referred to as the Shakopee and the Oneota members o f the Prairie du Chien Group. For general purposes, this report will consider the Prairie du Chien Group as a single unit. However, it is useful to note that although the rock itself in the lower Oneota formation tends to be more massive (i.e. denser, with little pore space) than the sandier overlying Shakopee formation, the Oneota tends to have more solution cavities. As a result, the Oneota provides the higher yield o f water to wells (Lindholm et al. 1974). Hydraulic conductivity is a measure o f how much water can pass through an aquifer, and depends not only on the amount o f pore space that water can pass through (the aquifer's porosity), but how well connected those pore spaces are to one another (the aquifer's permeability). The hydraulic conductivity o f similar fractured bedrock groundwater systems in southeast Minnesota has been shown to sometimes exceed several thousand feet per day (Runkel et al. 2007). Tipping et al. (2006) identified a zone near the contact o f the Shakopee and Oneota members o f the Prairie du Chien which has densely spaced fractures - this create a horizon where groundwater flow rates are very high. This zone o f high flow rates is referred to as the "high transmissivity zone". Below the Prairie du Chien is the Jordan Sandstone. Pumping wells in the Jordan can cause groundwater to move downward from the Prairie du Chien into the Jordan. Preliminary modeling o f groundwater flow by MDH suggests that groundwater flow from the Prairie du Chien to the Jordan may be occurring primarily in the areas immediately around municipal wells as a result o f the high pumping rates of those wells (A . Djerrari, MDH, personal communication, 2007). Beneath the Jordan Sandstone is the S t Lawrence formation, composed o f dolomite and siltstone. This formation is not considered an aquifer but rather a "confining unit" because it has low vertical permeability, so groundwater generally does not move downward through it. This means that in most areas, the St. Lawrence "protects" the aquifers beneath it from downward migration o f contaminants. Below the St; Lawrence formation, in descending order, are the Franconia, Ironton, and Galesville sandstone aquifers (which are often considered to be one single aquifer), the Eau Claire confining unit, and the Mount Simon sandstone aquifer. Under natural conditions, the top o f the water table at the 3M-Woodbury Disposal Site is located approximately 80-120 feet below the ground surface. The large volumes o f water (an average o f 4.6 million gallons per day) being removed by the groundwater containment system at the site has lowered the water table, especially near the pump-out wells, so that the depth to the top o f the water table is now between 80-140 feet below ground. 10 p. 36 PFC Analysis In late 2003, the MDH Public Health Laboratory developed a method to analyze water samples for two PFCs, perfluorooctane sulfonate (PFOS) and perfluorooctanoic acid (PFOA). These two PFCs have been die focus o f the majority o f the scientific research on perfluorochemicals. PFOA and PFOS accumulate in humans and other species (EPA 2002, OECD 2002). PFOS, but not PFOA, has been shown to bioaccumulate in fish. Both have been found to be widespread in the environment. PFOA was produced at the 3M-Cottage Grove plant on a large scale; some PFOS production or use also reportedly occurred (MDH 2005). In the spring o f 2006, the MDH Public Health Laboratory expanded their PFC method to include a total o f seven PFCs. This was done in response to a request from the MPCA in late 2005 following the detection o f other PFCs in soil and water samples collected by the MPCA at the former Washington County Sanitary Landfill and analyzed by a laboratory in British Columbia, Canada (Axys Analytical Services). The seven PFCs currently being analyzed in drinking water by MDH are: PF B A : Perfluorobutanoic acid PFPeA : Perfluoropentanoic acid PFH xA: Perfluorohexanoic acid PFOA : Perfluorooctanoic acid P F B S : Perfluorobutane sulfonate PFHxS : Perfluorohexane sulfonate PFO S: Perfluorooctane sulfonate Water samples are collected in clean 250 milliliter polyethylene bottles. Care is taken to avoid the use o f products that could contain PFCs during sampling. The analysis is conducted using a combined high-pressure liquid chromatography tandem mass spectrometry (LC/MS/MS) method, using radio-labeled PFOA and PFOS standards. Each sample is spiked in the lab with a known quantity o f labeled standard. The recovery rate o f the added standard must be within 30% o f the known labeled standard concentration added to the sample to meet quality control requirements. In September 2007, the MDH Public Health Laboratory issued new formal reporting levels for the seven PFCs o f 0.3 parts per billion (ppb), or 300 parts per trillion (ppt) in water (P. Swedenborg, personal communication, 2007). PFCs detected at concentrations between 50 and 300 ppt are reported as estimated, or "J" flagged values. Evaluation o f PFCs in Drinking Water MDH has established Health Risk Limits (HRLs) in Minnesota Rules o f 0.3 ppb for both PFOS arid PFOA. In February 2008, MDH established a Health Based Value (HBV) for PFBA o f 7 ppb based in part on toxicological and pharmacokinetic studies completed in late 2007 by EPA and 3M. A HBV is a criterion that is established using the same risk assessment procedures and policies used for HRLs, but that has not yet been promulgated through rulemaking. Information on MDH HRLs and HBVs, including the specific methodology, exposure assumptions, and references, is available at http://www.health.state.nin.us/divs/eh/risk/guidance/gw/index.html. 11 p. 37 Because specific information on PFBA toxicity heeded to develop a HBV was lacking, MDH could not establish a HBV for PFBA before February 2008 (see http://www.health.state.mn.us/divs/eh/risk/guidance/gw/pfba.pdf). Therefore, as a cautious public health approach, prior to the issuance o f the HBV for PFBA MDH used a level o f 1 ppb as a "point o f departure" for offering advice to private well owners about reducing exposure to PFBA. In other words, MDH was confident that exposure to PFBA in drinking water at levels below 1 ppb was unlikely to be o f health concern. Because MDH could not quantify the potential health risk at levels above 1 ppb, advice was provided to those private well owners (or community water supply customers) on how to reduce their exposure if they chose. The available scientific information for the four remaining PFCs that MDH currently analyzes for is more limited than the information available for PFOS, PFOA, or PFBA. Based on their chemical characteristics, it is anticipated that research will show that PFPeA and PFHxA are generally less toxic than PFOA and, like PFBA, have a short halflife. PFBS and PFHxS have been studied more extensively. PFHxS in particular is known to have a long half-life in humans (see below). MDH has reviewed the available toxicological information on PFBS and PFHxS, and recently established an HBV for PFBS o f 7 ppb (see http://www.health.state.mn.us/divs/eh/risk/guidance/gw/pfbs.pdf)MDH staff determined that there was insufficient information to establish an HBV for PFHxS. HRLs and HBVs are used by MDH to determine if a drinking water well advisory is warranted for an individual well. The MPCA uses MDH advisories to take actions to protect public health from long-term exposure to PFCs, such as providing bottled water or individual water treatment. In cases where a combination o f PFOS, PFOA, and PFBA are present, but do not exceed their individual HRLs or HBV, MDH calculates a Hazard Index to account for possible effects o f exposure to more than one PFC at a time. The Hazard Index is the sum o f the ratios o f the concentrations o f PFOS and PFOA over their individual HRLs, and PFBA over its HBV. If the Hazard Index exceeds a value o f one, a drinking water well advisory is issued. Community Well Monitoring In late 2004, after releases o f PFCs were documented at the 3M-Cottage Grove facility (later described in MDH 2005), MDH worked with 3M to collect samples from municipal wells in Cottage Grove and Hastings for analysis for PFOS and PFOA. The samples were collected under the supervision o f MDH and city staff, and were sent to Exygen Research (now MPI) in State College, Pennsylvania for analysis. Neither PFOS nor PFOA were detected in the eleven Cottage Grove community wells. A trace o f PFOA (defined as between 25 and 50 ppt) was detected in one o f five Hastings community wells. In mid-2006, the MDH Public Health Laboratory expanded the list o f PFCs for analysis and lowered the analytical detection limits as described previously. Low levels o f PFBA (0.1 to 0.3 ppb) were detected in several Woodbury community wells during routine sampling. No other PFCs were detected. By fall o f 2006, it was found that low levels (0.1 12 p. 38 to 0.5 ppb) o f PFBA were present in all 16 Woodbury community wells. Although the presence of PFBA in those wells appears to be the result o f PFCs moving away from the 3M waste disposal sites in Oakdale and Lake Elmo (MDH 2008), the city o f Cottage Grove requested that their community wells be re-tested for PFCs using the expanded PFC list. In December 2006, PFBA was detected in all o f the Cottage Grove municipal wells at concentrations ranging from 0.3 to 1.5 ppb. The detection o f PFBA at concentrations higher than those found in the Woodbury city wells suggested that the PFCs in the Cottage Grove city wells were from another source located in or near Cottage Grove, rather than the 3M-Oakdale Disposal Site and Washington County Landfill. The detections o f PFBA in community wells in Woodbury and Cottage Grove triggered sampling o f other community wells in south Washington and northern Dakota Counties to determine if they had been impacted by PFCs, beginning in January 2007. This sampling eventually included Woodbury, Cottage Grove, Newport, St. Paul Park, Hastings and South St. Paul; PFBA was detected in some or all o f the community wells in each o f these cities. Low levels (0.44 ppb on average) o f PFBA were also found in a community water supply well serving a housing development in Cottage Grove known as Eagles Watch, in the eastern part o f the city. Sampling was conducted on a monthly basis in 2007 to determine if the levels o f PFBA were changing. Sampling frequency changed from monthly to quarterly in 2008 when it became apparent that the levels were stable or even declining slightly. The average and range o f concentrations o f PFBA detected in the wells serving each community's water supply system from January 2007 through September 2009 are shown in the table below. Community Wei PFBA Data, Jan. 2007 - Sept 2009 No. of Comm. No. of Comm. City Wells Wells w/PFBA Range(ppb) Cottage Grove 11 11 0 .3 0 -1 .7 8 Hastings 5 5 0 .1 2 -0 .6 7 Newport 2 2 0.17-0.69 St. Paul Park 3 3 0.96-2.30 South St. Paul 5 3 0.08-0.37 Woodbury 17 17 0 .0 7 -0 .5 5 Avg. of all Detects (ppb) 1.00 0.26 0.42 1.36 0.20 0.27 PFBA is the only PFC that has been detected in community wells in Newport and South St. Paul. Low levels o f PFBS (up to 0.32 ppb) and PFHxS (up to 0.16 ppb) have been consistently detected in three Cottage Grove community wells; trace amounts o f PFPeA and PFHxA (less than 100 ppt) have also been intermittently detected in various Cottage Grove community wells (see Table 4, Appendix 2). PFOA has been intermittently detected at approximately 50 ppt in one Hastings well and one St. Paul Park well. In Woodbury, PFHxS has been intermittently detected at approximately 50 ppt in one well, and PFOA was detected once at 50 ppt in one community well. 13 p- 3 9 Levels o f PFBA appear to be stable or declining slightly in many o f the community wells that have been regularly sampled by MDH since early 2007. As an example, Figure 6 is a graph o f the concentration o f PFBA in the 11 Cottage Grove community wells from January 2007 to September 2009. The reasons for a decline are unclear, but could reflect 1) an actual decline in the levels o f PFBA in the Jordan aquifer; 2) movement o f the contamination plume through increased pumping o f community wells to meet demand; or 3) improvements in the accuracy o f the analytical method over time. Continued data collection should help determine if the decline is real, and shed some light as to its causes. MDH has also sampled several dozen non-community public wells located at churches, businesses, parks, and other locations throughout southern Washington and northern Dakota Counties. Results from these wells showed either no or low levels o f PFBA. Private Well Sampling In 2005, as a result o f being informed by 3M that PFC containing wastes may have been disposed o f at the 3M-Woodbury Disposal Site, 3M's consultant, Weston Solutions, Inc. (Weston) collected groundwater samples from monitoring wells at the site (Weston, 2007a). PFOA, PFOS, PFBS and PFHxS were reported in monitoring wells on the landfill property in both the Prairie du Chien and Jordan aquifers and the water discharged from the pump-out wells at the site (Table 1, Appendix 2). The samples were not analyzed for PFBA. In June 2005, the MPCA and MDH collected water samples from 15 private wells near the disposal site. These wells were selected as being representative o f the Quaternary sand and gravel deposits above the bedrock and the three bedrock aquifers (St. Peter, Prairie du Chien, and Jordan) in use near the disposal site. At that time, PFOS and PFOA were the only PFCs for which analytical methods had been developed by the MDH Public Health Laboratory. Neither PFOA nor PFOS were detected. In late 2006 - early 2007, the detection o f PFBA in Woodbury, Cottage Grove, and several other city wells led to sampling o f residential and non-community public wells (such as churches, businesses, etc.). Sampling o f these wells indicated the area o f PFBA contamination also included the communities o f Grey Cloud Island Township, Denmark Township, the western edge o f Afton, and the southernmost portion o f Maplewood. The total area o f PFBA contamination (including the areas affected by the Oakdale and Lake Elmo sites) encompasses over 100 square miles. Residents within this area (and in all of Washington County) rely entirely on groundwater as the source o f their drinking water. M ost residents are connected to city water, but it is estimated there over 4,000 private w ells in these communities. Given the scope o f the potentially affected area, a private well sampling program was developed to provide rapid information regarding how far and how deep the PFC contamination had spread and where the highest concentrations were located. The state's County Well Index (CWI) was used to identify wells with geologic information in recorded driller's logs. Wells drawing water from each o f the drinking water aquifers 14 used in the investigation area were selected to provide geographic coverage o f all o f the neighborhoods in the potentially affected communities. More intensive sampling (i.e. sampling a higher density o f wells) was undertaken in the following areas: 1) closest to and downgradient o f the disposal site, 2) where PFBA concentrations were highest, 3) where the bedrock geology is complicated by faults and/or bedrock valleys, and 4) where spatial trends in PFBA concentrations were unpredictable. Sampling proceeded in an iterative fashion - with each round o f sampling results informing decisions about the next round o f samples. This allowed the MPCA and MDH to refine the sampling plan to identify and focus on areas o f greatest potential health concern. By the end o f 2008, water samples had been collected from over 900 residential and 56 business wells in the affected communities. A general summary o f sampling results is provided in Table 2 (in Appendix 2). The most commonly detected contaminant in private and business wells in the investigation area is PFBA. PFPeA is also frequently detected, but is typically found only in wells with PFBA concentrations o f 1 ppb or greater. Most o f the wells sampled were completed in the Prairie du Chien, Jordan, and Franconia aquifers, or had no record to indicate the aquifer in which they were completed. Figures 7 - 1 0 show the distribution o f PFBA in the four major drinking water aquifers (St. Peter, Prairie du Chien, Jordan, and Franconia). Other PFCs have been detected at the 3M-Woodbury Disposal Site and in two isolated areas o f Cottage Grove. The first area is located south and west o f Highway 10, primarily in the Langdon and River Acres neighborhoods, where multiple PFCs have been detected at low concentrations in some private wells. The second area is the main Cottage Grove city well field, where trace levels o f PFHxS, PFBS, PFPeA, and PFHxA have been detected in several community wells. Further information on these detections is provided below. PFC-Related Investigations at the 3M-Woodbury Disposal Site To better define residual PFC levels in soil and waste materials at the site and provide some clues as to the source(s) o f PFCs in groundwater, in April 2007 3M's consultant, Weston, installed a series o f soil borings in the former Northeast Disposal Area (Weston 2008a). Available historic information for the site suggested the presence o f two trenches separated by soil mounds. A total o f 14 soil borings were drilled using direct-push drilling technology, generally to a depth o f ten feet. Selected borings within the trench features were advanced to the bedrock, approximately 20 feet deep. Soil samples were collected continuously to characterize the soil cover (1.5 to 6.5 feet) and backfill material (1.5 to 17 feet) thickness and depth, as well as other descriptive information. Soils were also screened for organic vapors and pH. Selected soil samples were collected based on visual appearance and sent to the 3M Environmental Laboratory for PFC analysis. Selected samples were also analyzed for VOCs. 15 p. 41 The soil boring Locations and results for PFOS, PFOA, and PFBA in the Northeast Disposal Area are presented in Figure 11. PFC concentrations were generally higher in the backfill material in the former trench areas than in the mound areas. PFOA was detected in each o f the soil samples collected in the former trench areas, at levels that range from 1,220 ppb to 26,100 ppb. Lower levels o f PFBA were detected in 20 o f 21 soil samples collected in the former Northeast Disposal Area. PFBA levels in the former trench areas ranged from 15 to 175 ppb. PFOS was detected in 11 o f the 12 samples collected from backfill material in the former trenches. Detected concentrations ranged from 2,800 to 19,300 ppb. Other PFCs were infrequently detected; most notable was PFHxS in 11 soil samples at levels that ranged from 283 to 10,100 ppb. Petroleum related and chlorinated VOCs were also commonly detected in soil samples. In the fall o f 2007, soil borings were installed to further assess the material remaining in the disposal trenches at the former Main Disposal Area and Municipal Fill Areas for PFCs. Eighteen direct-push borings were completed within the eight former Main Disposal Area trenches (A-H) and two former Municipal Fill Areas (I, J). With approval from the MPCA, soil samples from this rea were analyzed for a smaller list o f five PFCs (PFOA, PFOS, PFHxS, PFBA and PFBS). Two soil samples were collected and analyzed for the five PFCs from each soil boring, usually one sample from the bottom o f the disposal trench and a second sample from approximately five feet below the bottom o f the trench. The soils borings ranged in depth from eight to 28 feet. The soil boring locations and PFC results for these areas are shown in Figure 12. PFCs were detected at each o f the soil boring locations within the former Main Disposal Area. PFC concentrations in the samples collected from beneath the fill/waste material were either non-detect or were less than that o f the samples collected from the fill/waste material. The highest PFC concentration (PFOA at a concentration o f 3,020,000 ppb) was detected at boring GPA04 at a depth o f 16.5 feet. PFOS was detected at each o f the 14 borings in the Main Disposal Area, at concentrations that ranged from 197 ppb to 17,600 ppb. PFBA was detected at lower concentrations compared to PFOA and PFOS, ranging from 1 to 225 ppb. Lower levels o f PFCs were found in the soil samples collected from the four borings drilled in the former Municipal Fill Area. Investigations in Lake Elmo (MDH 2008a) have demonstrated the PFCs migrate readily from groundwater to surface water. In 2008, the MPCA requested that 3M collect a water sample from a small pond on the site known as Gables Lake. This pond is located approximately 2,000 feet south o f the former Main Disposal Area, as shown in Figure 3. A sample collected one foot below the surface o f the lake contained 0.103 ppb PFBA, 0.0913 ppb PFOA, and 0.0373 ppb PFOS (Weston 2009). In 2006-2007, twenty additional monitoring wells were installed to provide additional information about PFC distribution at the site and to monitor for any movement of contaminants away from the site (Weston, 2007a). Sampling has shown that PFCs are present in multiple monitoring wells at the site, primarily downgradient of the waste (Table 3, Appendix 2). The highest levels have consistently been found in monitoring well MW-2, near the Northeast Disposal Area (Figure 3). PFC concentrations at the site 16 p. 42 have been stable over the limited sampling period, and generally low concentrations are detected in wells near the boundaries o f the 3M property. However, only one o f the monitoring wells completed in the Prairie du Chien (well MW-S06PC) actually intersects the "high transmissivity zone" identified by Tipping, et al (2006), and it is located upgradient o f the waste disposal areas. 3M's consultant identified this zone as likely carrying the majority o f flow in the Prairie du Chien (Weston, 2008a). The absence o f monitoring wells intercepting this zone means it is possible that a critical pathway for PFC migration may be missed by the monitoring network. A groundwater remediation system is in operation at the 3M-Woodbury Disposal site. The system was originally installed to control migration o f VOCs. The groundwater remediation system includes four gradient control/recovery wells. The system pumps an average o f 4.6 million gallons o f water per day from the wells. The water is discharged through a six mile long pipeline to the 3M-Cottage Grove facility where it is primarily used for non-contact cooling water prior to discharge to the Mississippi River under a permit issued by the MPCA. A hydraulic conductivity zone analysis was conducted by Weston (2007b) which concluded the gradient control wells are fully containing the contamination on-site. This is consistent with previous evaluations o f the gradient control system. However, critical gaps in the monitoring network, as described above, make it impossible to verify this. To determine if potential leakage from the conveyance line could be contributing to groundwater contamination in South Washington County, the MPCA requested that 3M conduct a thorough evaluation o f the integrity o f the line (Weston 2008a). This was done over a period o f several weeks during April and May 2007. The evaluation was done using direct sensing technology wherever possible (i.e. it was not done by measuring water flow into and out o f the pipeline). No leaks were detected in the conveyance pipeline. There were two pipeline segments, located in Cottage Grove Ravine Park, where the evaluation was difficult because the segments were too long and inaccessible. Evaluating shorter pipeline sections in this area was not feasible due to the difficult physical setting (steep elevations, wooded areas, asphalt surfaces, etc.) and/or the pipeline depth (over 10 feet deep in some areas). 3M indicated that this portion o f the pipeline was more recently installed (in 2003) and that it was intact at that time. 3M has also indicated that there are pressure monitoring points where the four groundwater extraction wells enter the pipeline, and where the line ends at the 3M Cottage Grove facility (3M 2008). 3M has stated that any significant leaks from the line would be quickly detected and reported, and that no such leaks have been reported recently. MPCA - 3M Consent Order for PFC Disposal Sites At the MPCA April 24,2007 Citizens' Board meeting, the Board was asked to approve a series o f enforcement actions under the state Superfund law to compel 3M to respond to PFC contamination from three known PFC disposal sites: the 3M-Cottage Grove facility, the 3M-Woodbury Disposal Site, and the 3M-Oakdale Disposal Site. The former 17 p. 43 Washington County Landfill was not included because under the MPCA Closed Landfill Program, the MPCA has assumed responsibility for the site. Instead o f approving the enforcement actions, the Citizens' Board directed MPCA staff to negotiate a Consent Order with 3M on PFC contamination in Minnesota (MPCA 2007c). The Board directed staff to address seven concerns with regards to the disposal sites and proposed actions in the Order, as follows: 1. A rigorous, robust cleanup plan for the disposal sites. 2. Recognition o f the MPCA's jurisdiction. 3. Municipal and private drinking water supplies addressed. 4. Address future actions on PFBA. 5. Address additional studies on health and environmental effects. 6. Address cooperation from 3M on sharing research and information. 7. Preserve the MPCA's right to take action in the future. The MPCA and 3M negotiated the Order, and presented it to the MPCA Citizens' Board for approval at its May 22, 2007 meeting. The Citizens' Board unanimously approved the Consent Order with 3M. The consent order can be accessed on the MPCA web site at: http://www.pca.state.mn.us/cleanup/Dfc/index.html (MPCA 2007d): In the Consent Order, 3M has agreed to contribute up to $8 million to remediate the former Washington County Landfill. 3M is also obligated to under the Consent Order to provide alternate sources o f drinking water in the case where PFC levels in a public or private well exceed MDH health-based exposure limits. Also included in the Consent Order is an agreement that the MPCA does not waive its right to pursue any naturalresource damage claims related to releases o f PFCs from the sites. Such claims are allowed under state and federal law. 3M provides regular updates to the MPCA and MDH on various activities under the Consent Order; the MPCA Board is updated on a quarterly basis by MPCA and MDH staff on 3M's progress under the Consent Order. Remedial Options for the 3M-Woodbury Disposal Site Based on data collected during previous investigations conducted at the site, and the PFC-related investigations described above, 3M has evaluated various response action alternatives for the site (Weston 2008a). The alternatives evaluated by 3M and Weston, both sitewide and for specific contaminated media, include: Sitewide Alternative l - No action. Sitewide Alternative 2 - Institutional controls, access restriction and groundwater monitoring. Groundwater Alternative I - Continued groundwater recovery with GAC treatment, as necessary, to meet appropriate discharge criteria. Soil Alternative 1 - Excavation o f the former Northeast Disposal Area trenches; disposal at an existing off-site landfill. 18 p. 44 Soil Alternative 2 - Excavation o f the former Northeast Disposal Area trenches; disposal at an existing off-site landfill; and 4 feet (minimum) cover over selected areas in the former Main Disposal Area. Soil Alternative 3 - Excavation o f the former Northeast Disposal Area trenches and selective removal o f soil which exceeds Industrial SRVs from trenches in the former Main Disposal Area; disposal at an existing off-site landfill. Each o f the response action alternatives was evaluated against the primary goal o f protecting the public health and the environment. The proposed response actions also were evaluated in light o f the requirements agreed to by 3M in the Consent Order. Finally, the response action alternatives were evaluated using the following "balancing criteria:" 1) long-term effectiveness; 2) implementability; 3) short-term risks; and 4) total costs. A `no action' alternative is evaluated at every site. Based on these evaluations, 3M proposed the following recommended response action alternatives for the site: Institutional controls, access restriction, and groundwater monitoring (Sitewide Alternative SW-2), and Continued groundwater recovery with GAC treatment as necessary (Groundwater Alternative GW-1). 3M also stated that any o f the three soil alternatives were acceptable, but left the final decision to the MPCA. The MPCA selected Soil Alternative 3, which included the most extensive soil and waste excavation, and documented their decision in a Minnesota Decision Document for the site dated December 22,2008. After a cost-benefit analysis, it was determined that by slightly reducing the mass o f PFCs removed from the site, the cleanup could be completed much sooner and at less cost to the environment in terms o f fuel use, truck mileage, and landfill space. This "modified Soil Alternative 3" is in fact the plan being implemented at the site by 3M. Additional details on the cleanup o f the site, including various steps taken to prepare the site for cleanup can be found on the MPCA's web site at hnp:/7wvvw.pca.state.mn.us/cleanup/pfc/pfcsites.html. 3M began cleanup work at the site in the summer o f 2009. To date, 19,100 tons o f excavated soil and waste has been transported to the SKB Landfill in Rosemount, Minnesota, where a specially constructed, dedicated cell has been constructed to receive the soil and waste from the Woodbury and Oakdale sites, and waste that was buried at the 3M-Cottage Grove facility. An additional 4,100 tons o f excavated soil and waste has been transported for out o f state disposal at a permitted hazardous waste facility due to the presence o f other regulated contaminants. Site Visits MDH staff has conducted several visits to the 3M-Woodbury Disposal Site and its vicinity during the past three years to conduct private well searches, collect well water samples, and attend local government and public meetings. The 3M-Woodbury Disposal Site is partially fenced, and access from County Road 19 is limited by several locked gates. "No Trespassing" signs are also prominently placed 19 p. 45 along the fence and gates. 3M has regular security patrols at and around the site. 3M allows some o f the land to be used for agricultural purposes, and employee recreational activity clubs also use portions o f the site. Demographics. Land Use, and Natural Resources Nearly 150,000 people live in areas o f Washington and Dakota Counties where measurable levels o f PFBA have been detected in community water supplies or private wells. The estimated 2008 populations for the affected cities and townships are (Minnesota Department o f Administration 2009): Woodbury: 58,430 Cottage Grove: 34,017 St. Paul Park: 5,293 Newport: 3,542 Afton: 2,899 Denmark Township: 1,726 Grey Cloud Island Township: 362 Hastings: 22,488 South St. Paul: 20,250 These cities and townships represent a variety o f land uses, from a typical suburban mix o f compact residential areas, light commercial districts, and retail areas, to mainly rural residential and agricultural areas. The area has experienced significant population growth and development in the last ten to twenty years. In the larger cities, the majority o f the population is served by community water supplies, but more rural areas rely on private w ells for drinking water, and will for the foreseeable future. The area is home to numerous parks and recreational areas, including Afton State Park, St. Croix Bluffs and Cottage Grove Ravine Regional Parks, Point Douglas Park, and the Carpenter Nature Center. MDH has collected water samples from drinking water wells within the parks to look for the presence o f PFCs. Low levels o f PFBA were detected in two wells serving the Carpenter Nature Center (0.9 and 1.8 ug/L), one well at Cottage Grove Ravine Regional Park (0.5 ug/L), and the well serving Point Douglas Park (0.1 ug/L). No PFCs were detected in wells at Afton State Park, or St. Croix Bluffs Regional Park. Both o f these parks are on the eastern border o f Washington County, along the St. Croix River. In August 2007 MDH issued a press release announcing revised fish consumption advice for several lakes in the Twin Cities metro area, including Ravine Lake, which is located within Cottage Grove Ravine Regional Park. The press release was issued due to the detection o f PFOS in fish tissue samples collected by the MPCA from several lakes at levels high enough to warrant revised fish consumption advice for certain fish species. In the case o f Ravine Lake, fish consumption advice was issued recommending no more than one meal per week o f black crappie and largemouth bass. Additional data collected by the MPCA later in 2007 resulted in new fish consumption advice being issued for one other lake in south Washington County, Powers Lake in Woodbury, based on PFOS 20 p. 46 levels in fish. For specific guidance, please refer to MDH's Fish Consumption Advice web site at httn://www.health.state.mn.us/divs/eh/(ishyindex.html. The specific source o f the PFOS detected in fish in these lakes is not dear. General Regional Issues This region o f the eastern Twin Cities metropolitan area will likely continue to experience substantial population growth in the coming years, although development has slowed recently due to the economic downturn in 2008. Because continued growth may present a strain on area resources such as water supplies, the need for expansion o f water supply systems has been evaluated by the cities and new community supply wells will be needed. The widespread PFC contamination in the aquifers typically used for municipal water supplies has complicated this process. Currently, Woodbury and Cottage Grove are in the process o f siting or constructing new community wells to meet projected demand. Community Concerns MDH staff have had numerous contacts with citizens living in the affected areas o f Washington, Dakota, and Ramsey Counties who have expressed concern about PFCs in their private well or the community water supply. Community meetings were held by MDH in Hastings, Woodbury, Cottage Grove, St. Paul Park, and South St. Paul in February 2007, and again in February 2008. A total o f approximately 400 people attended these meetings. MDH has also attended many other local meetings in the two cites, and responded to hundreds o f phone calls and e-mails. Some residents have expressed concern about the following: that cancer or other disease rates in the area seem higher than normal, the health implications for children who may have been exposed to contaminated water (both before and after birth), and the health o f domestic animals that may be drinking contaminated water. Residents also had questions about multiple exposure pathways to PFCs, and the lack o f health-based exposure limits for some PFCs in water. MDH has made every effort to address these health issues where possible. MDH has produced multiple information sheets for area residents, regularly updated its web site on PFCs (www-health.state.nm.us/divs/eh/hazardous/topics/pfcs/index.html). and created an email distribution list (1,330 subscribers as o f September 2009) to notify interested residents and local officials o f new information. The cities (and Washington County) have also provided updates for local residents in their city newsletters, annual water quality reports, and web sites. There have also been numerous stories in state, Twin Cities, and local media. Evaluation of Environmental Fate and Exposure Pathways Introduction PFCs, primarily perfluorooctanoic acid (PFOA; CsFisOH) and one o f its salts, ammonium perfluorooctanoate (APFO; CsFisChNH-t), as well as lesser amounts of other PFCs such as perfluorooctanesulfonyl fluoride (POSF; CsFnSChF) and perfluorobutanoic acid (PFBA, C4F7O2H) were manufactured by 3M at their Cottage Grove facility 21 p. 47 (formerly known as Chemolite) from the early 1950s until 2002. PFBA production reportedly ceased in 1998. One o f the byproducts o f the production o f POSF is perfluorooctane sulfonate (PFOS; CsFi?S03'), which can also be produced by the subsequent chemical or enzymatic hydrolysis o f POSF. The chemical structures o f PFOA, PFOS, and PFBA are shown in Figure 2. PFCs were produced at the 3M Cottage Grove facility using an electrochemical fluorination process, a batch process where hydrogen fluoride was added to organic molecules and electricity was applied to facilitate the complete replacement o f hydrogen atoms with fluorine. A unique aspect o f this process was the production o f both straightchain and branched isomers (Prevedouros et al. 2006)1 The other main PFC production process (and the one currently in use by the remaining PFC manufacturers) is a fluorotelomer process and produces only straight-chain molecules. This fact could help distinguish PFCs found in the environment or in living things as having originated from historical PFC manufacture and waste disposal (such as from the various disposal sites historically used by 3M) as opposed to the modem use of PFCs in commercial products (D e Silva and Mabury 2006). In January 2006, the administrator o f the EPA initiated the PFOA Stewardship Program, in which the eight major companies who remained in the PFOA industry (including 3M, through its subsidiary Dyneon) committed voluntarily to reduce facility emissions and product content o f PFOA and related chemicals on a global basis by 95 percent no later than 2010, and to work toward eliminating emissions and product content o f these chemicals by 2015 (EPA 2006). 3M/Dyneon has already met the 2010 goal. There are still some commercial uses o f PFOS in specialty products (primarily in the semi conductor, metal plating, and aviation industries). To the knowledge o f MDH, there is currently no commercial production o f PFBA in the U.S., but some PFBA is reportedly imported for commercial applications and for use in analytical laboratories. In its reformulated stain repellent and other commercial products such as ScotchgardTM, 3M used a chemistry based on the four carbon sulfonic acid PFBS, instead o f the eight carbon PFOS (Brezinski 2003). Environmental Fate The carbon-fluorine bond is a high-energy bond, one o f the strongest known among organic molecules. As a result, the chemical structures o f the PFCs described above make them extremely resistant to natural breakdown, and they are persistent once released to the environment. Their structure also makes them excellent surfactants. The word surfactant is an acronym for 'surface active agent' - a molecule that lowers surface tension in a liquid. Surfactant molecules contain both a hydrophobic (`water-hating') and hydrophilic ( `water-loving') component, making them semi-soluble in both organic and aqueous solvents. Surfactants are the active ingredients in soaps and detergents, where the hydrophobic component sticks to grease and dirt while the hydrophilic section sticks to water, helping to remove dirt from skin and hair and stains from fabric. These same properties can also be used to essentially help make materials resistant to water and stains, one o f the primary markets for these chemicals. Information on the physical properties o f PFCs that would make them potentially useful in industrial applications was 22 p. 48 published by 3M scientists in technical journals as far back as the early 1950s (Kauck and Diesslin 1951; Reid etal. 1955). On the basis o f its physical properties, PFOS is essentially non-volatile, and would not be expected to evaporate from water (OECD 2002). In soil-water mixtures, PFOS has a strong tendency to remain in water due to its solubility (typically 80% remains in water and 20% in soil). PFOS does not easily adsorb to sediments, and is expected to be mobile in water at equilibrium (3M 2003a). PFOA is slightly more volatile than PFOS, although it also has a very low volatility and vapor pressure (EPA 2002). PFOA salts are very soluble and completely disassociate in water; in aqueous solution PFOA may loosely collect at the air/water interface and partition between them (3M 2003b). In published studies and reports, PFOA has shown a high mobility in some soil types (EPA 2002). In a study o f the sorption potential for various PFCs in sediments, Higgins and Luthy (2006) found that the carbon chain length had a major effect on soiption potential - the longer the chain the more likely adsorption would occur, and that perfluorosulfonates (i.e. PFOS) tended to bind more readily to sediment than perfluorocarboxylates (i.e. PFOA). Other environmental conditions that could affect adsorption include organic carbon content o f the sediment, pH, and dissolved calcium. Other studies have shown generally similar results, and adsorption behavior in soils is likely to be very similar to that observed in sediments (Prevedouros et al. 2006). A review o f the bioaccumulation potential o f a variety o f PFCs by Conder et al (2008) found similar results, in that PFOS and longer chain perfluorocarboxylates (greater than eight carbons) had a greater potential to accumulate in living organisms. The vapor pressure and water solubility o f PFBA are similar to PFOA (Kwan 2001). PFBA is very soluble in water, and appears to travel easily with groundwater. A number o f fluorinated compounds are in fact used as tracers in groundwater flow studies due to their environmental persistence and negligible adsorption to soil and aquifer materials (Flury and Wai 2003; Shapiro, 2008). The study o f sediment adsorption o f selected PFCs by Higgins and Luthy (2006), which unfortunately did not include PFBA, nonetheless supports the notion that PFBA may be even more mobile than PFOA or PFOS in the environment because it is a perfluorocarboxylate with a short carbon chain length. Evaluation o f Impacts on Groundwater The information obtained from investigation and remedial activities at the disposal sites, surface water sampling, and sampling o f private, municipal, and non-community wells has been used to evaluate the magnitude, extent, and possible migration history o f the PFC contamination in south Washington County. The highest concentrations o f PFBA are detected south o f the site and appear to follow the buried bedrock valley that underlies the western edge o f the site and trends south through Cottage Grove Ravine Park to the Mississippi River. PFBA has been detected in all four o f the major drinking water aquifers in the investigation area, with the most widespread contamination documented in the Prairie du Chien and Jordan aquifers (these are also the aquifers most widely used in this area). The extent o f contamination in the St. Peter (and overlying Quaternary sands and gravels) is poorly understood, due to the few number o f wells 23 p. 49 present in those aquifers. Contamination in the Franconia is generally low in concentration and appears to be localized near major bedrock faults that have brought the Franconia into contact with the Jordan (Figure 4), allowing PFCs in the Jordan to migrate into the Franconia. A n area of contaminated groundwater is often referred to as a "plume" (like a plume of smoke). "Typical" contaminant plumes have their highest concentrations near the source area, decrease in concentration with distance from that source, and are roughly elliptical in shape with the axis o f the plume aligned roughly with the direction groundwater is flowing. In contrast, the PFBA plume in the investigation area is quite complex (see Figures 8 and 9). While concentrations are high near the source area, there are scattered patches o f higher concentrations that don't appear to connect back to the source area. In part, this appears to be due to the influence o f bedrock structures, such as buried valleys and faults. In both Figures 8 and 9, a zone o f higher PFBA concentrations trends southward from the 3M-Woodbury Disposal Site and appears to follow the course o f the bedrock valley in that area. Similarly, a patch o f higher PFBA concentrations near the border o f Cottage Grove, St. Paul Park, and Newport (shown in yellow, just southeast o f the intersection o f Hwy 61 and 1-494) appears to follow the outline o f the bedrock valley in that area (see Figure 8). An arm o f that valley appears to trend back toward the site, but an absence o f wells in this area limits our ability to definitely trace the zone o f higher PFBA concentrations back to the site. Another unusual area within the plume is the seemingly isolated area o f PFBA present in the Jordan aquifer near the St. Croix River in the southeastern portion o f the investigation area (Figure 9). However, this area is bounded by a series o f major bedrock faults and the top o f the Jordan east o f this faulted zone is over 200 feet lower in elevation than the top o f the Jordan to the west o f the zone. The Jordan on the east side o f this heavily faulted zone is essentially at the same elevation as the Franconia aquifer on the west side. A s shown in Figure 10, PFBA is present in the Franconia west of the faulted zone and at concentrations similar to those found in the Jordan east o f the fault In other words, the PFBA plume appears to be migrating from the Jordan into the Franconia across a fault near the ravine, traveling through the Franconia as the groundwater moves to the eastsoutheast, and then crosses another fault and back into the Jordan near the St. Croix River, as illustrated in Figure 4. PFBA is also moving south from the two 3M waste disposal sites in Lake Elmo and Oakdale (Figure 1), further complicating our understanding o f the PFBA distribution. It is likely that the PFBA detected in east Woodbury and west Afton actually has migrated southeast from the Washington County Landfill. Similarly, the PFBA detected in south Maplewood and northern Woodbury likely migrated south-southwest from the 3MOakdale Disposal site. Elsewhere in the investigation area, it is difficult to determine how much, if any, o f the PFBA detected has been contributed from these two northern sites. There are also areas with unusual PFBA distribution patterns that, at present, cannot be attributed to bedrock structures or migration from the northern disposal sites. The most striking o f these is the "finger" o f elevated PFBA in the Prairie du Chien aquifer 24 p. 50 extending north o f the 3M-Woodbury Disposal Site (Figure 8). Although it appears to follow the same northeast-southwest trend o f the faults in the area, no fault has been identified in this portion o f the investigation area. One possibility is that several large capacity wells (city and irrigation wells) located north o f this "finger" o f PFBA, may be drawing some o f the contamination in this direction. Pump tests at the site suggest the high volumes o f water being removed by the groundwater capture system would prevent this from occurring, and water level measurements do not indicate influence by off-site w ells affecting this portion o f the site. It has been suggested this "finger" may be a remnant o f a plume that was established before the pump-out system began operation. However, the high capacity wells north o f the site were constructed after 1990 and the pump-out system began operation in the early 1970s. If this "finger" o f PFBA was established before groundwater extraction began at the site, the mechanism permitting the PFBA to migrate against the regional groundwater flow is unknown. Although PFBA is the most widely detected PFC in Washington County, multiple PFCs were detected at the disposal site and the 3M Cottage Grove facility, and are also found in private wells in several isolated areas o f Cottage Grove (Figure 13). The largest area is located south and west o f Highway 61, primarily in the Langdon and River Acres neighborhoods, where non-PFBA PFCs (PFOA, PFOS, PFHxS, PFBS, PFPeA, and PFHxA) have been detected in some private wells, generally at low concentrations (see table below). Although Figure 13 shows three distinct areas with multiple PFCs south o f Highway 61, there are few wells between these areas so it is not possible to determine whether they are hydraulically connected or separate plumes. The second area is the main Cottage Grove city well field, where trace levels of PFHxS, PFBS, PFPeA, and PFHxA have been detected in several o f the wells (Table 4, Appendix 2). A trace level o f PFHxA (0.06 ppb) has also been detected in one well near Tower Road, but this result has not been confirmed. Maximum Concentrations of non-PFBA PFCs in Langdon/River Acres Area PFOA PFOS PFPeA PFHxA PFBS PFHxS 1.4 0.9 0.3 0.16 0.12 0.15 A ll concentrations in pg/L The presence o f multiple PFCs, other than PFBA and PFPeA, in these two areas is unusual because none o f those compounds are detected in wells between the disposal site and the two areas described (Figure 13). While the actual source is as yet unknown, it is possible that the multiple PFCs detected in these areas may be related to fire-fighting activities. Some specialized types o f fire-fighting foams contain PFCs. The Cottage Grove Fire Department originally reported to the MPCA that it used small amounts o f such foam in their training activities, which occur near the main city well field (Delta, 2008). However, the department later stated that although they use PFC-bearing foams, they do not use them for training purposes. As a result, the source of the multiple PFCs in the area o f the city well field remains uncertain. The possible link to fire-fighting chemicals in the areas south o f Highway 61 appears to be stronger. In 2002, PFC-bearing foams were used to extinguish a major industrial fire immediately south o f Highway 61 and the foams reportedly discharged to a surface water infiltration pond immediately 25 southwest o f the Langdon neighborhood and upgradierit of the River Acres neighborhood. The MPCA is currently investigating what, if any, role fire-fighting foams may have played in creating the anomalous PFC signature in this area. On-going monitoring o f private wells continues to track PFC concentrations in each of the affected drinking water aquifers across the investigation area over time. As with the initial sampling effort, more wells are sampled in areas with higher PFC levels, where the geology is complex, and/or the PFC concentration spatial trends are unpredictable. In areas where concentrations are lower and the distribution patterns are predictable, "sentry w ells" selected to provide representative results for each o f the aquifers in use in that area and to act as an early warning "sentry" for any unusual results that might warrant sampling of additional wells in the area. The sampling schedule, both in terms o f frequency and number o f wells, is adjusted as more data is collected and the behavior o f the PFC plume in the affected communities is better understood. Sampling o f the monitoring wells at the disposal site also indicate stable concentrations and appear to indicate that PFCs are not migrating off-site, as a result o f the groundwater capture system in operation there. However, as noted above, the absence o f downgradient monitoring wells screened across die "high transmissivity zone" in the Prairie du Chien, may represent an important gap in the integrity o f the monitoring network. The monitoring results indicate PFC concentrations in all o f the aquifers are quite stable. This is consistent with findings in Lake Elmo and Oakdale (MDH 2008a) and suggests that the size, shape, and concentrations o f the PFC plumes in the individual aquifers may have reached a state o f equilibrium (i.e. are not changing). 'Based on our understanding o f the way PFCs move in the groundwater environment and the high flow velocities known to exist in the investigation area, it is likely the PFCs from the disposal site migrated rapidly through the affected communities relatively soon after the wastes were disposed and what is present today are remnants o f contaminants slowly washing out o f the aquifers. This slow washing out o f contaminants is sometimes referred to as "secondary flow" or "matrix diffusion", and occurs because there are major (i.e. larger, faster) flow paths and minor (i.e. smaller, slower) flow paths within the aquifer (Figure 14). The majority o f the contaminants flow quickly through the major flow paths in an initial "pulse", rapidly establishing the contaminant plume, while contaminants that have m oved into the minor flow paths slowly release over time at more dilute concentrations. I f this is what happened in the investigation area, earlier concentrations in the aquifers m ay have been higher than what is currently being detected. However, it is impossible to calculate how high those concentrations might have been or how long the higher concentrations may have lasted. The persistence o f PFCs in the environment means that ultimately the PFCs in the groundwater in Washington County will discharge to the Mississippi and St. Croix Rivers. However, the low concentrations in the groundwater and the large volume of flow in the rivers will likely dilute this discharge to extremely low concentrations. Samples o f water from the Mississippi River were collected as part o f the investigation of 26 the waste disposal areas at the 3M Cottage Grove Plant (MDH 2005; Weston 2008c). While elevated concentrations o f PFCs were detected in samples near and immediately downstream o f the plant, no PFCs were detected in water samples collected upstream o f the plant. Low levels o f PFOS (0.289 - 1.34 ppb) were detected in sediment samples collected upstream o f the plant. PFOS represents a very minor component o f the PFC plumes in south Washington County and it is unlikely that discharge o f those plumes contributed significantly to the PFOS detected in the sediment samples. Exposure through Private Wells PFCs can affect humans only if the chemicals move from the environment and come into contact with or accumulate in a person's body. The movement o f PFCs (or other contaminants) from the environment into a person's body is called an exposure pathway. A n environmental exposure pathway contains five parts: (1) a source o f contamination, (2) contaminant transport through an environmental material (i.e., soil, air, water, or food), (3) a point o f exposure, (4) a route o f human exposure, and (5) a receptor population. An exposure pathway is considered complete if evidence exists that all five o f these elements are, have been, or will be present in a community or a given situation. More simply stated an exposure pathway is considered complete when people are likely to be exposed to the chemical o f concern. A pathway is considered a potential exposure pathway if at least one o f the elements is missing but could be found at some point. An incomplete pathway is when at least one element is missing and will never be present. A completed environmental exposure pathway to PFCs from the disposal o f PFCcontaining wastes in disposal sites in Washington County exists primarily from consuming PFC contaminated water. The consumption of fish from local lakes or rivers where PFOS has been detected in fish populations also represents a completed exposure pathway, although the source o f the PFOS may not be in all cases from land disposal o f PFC-containing wastes. Samples have been collected from over 900 private wells and 56 business wells in Woodbury, Cottage Grove, and other communities in south Washington County (south o f 1-94). PFCs have been detected in 745 private and business wells. No wells, public or private, south o f 1-94 have been found to contain PFBA at concentrations above the Health Based Value (HBV) o f 7.0 ppb for PFBA. A s o f late 2009, 29 private well owners in Cottage Grove and Grey Cloud Island had received a drinking water well advisory from MDH due to the presence of PFCs. Nine o f these private wells have PFOA at concentrations above the HRL o f 0.3 ppb; one also has PFOS at concentrations above the HRL o f 0.3 ppb. In 12 o f these wells, concentrations o f PFCs exceed a Hazard Index value o f one based on multiple PFCs. At the other seven wells, levels of PFCs are below current health advisory levels but the drinking water well advisories remain in effect due to uncertainties over long-term concentration trends and potential changes in the PFC plumes that could result from site remediation activities. All o f these wells are located in neighborhoods south o f U.S. 27 Highway 61, in the area o f anomalous PFC detections, as discussed above. One o f the w ells was sealed by the MPCA, at the owner's request. Where drinking water well advisories have been issued by MDH, exposures have been reduced to acceptable levels by the provision o f bottled water and/or GAC filters by the MPCA. It is also possible that the use o f owner-installed filter systems may have reduced past exposure to PFCs in drinking water. During the course o f the investigation, it was found that a number o f private well owners who subsequently received a drinking water well advisory due to PFCs had previously installed reverse osmosis water filters to remove nitrate, a common groundwater contaminant in the area. Reverse osmosis filters, i f .maintained properly, are also very effective at removing PFCs according to a study conducted by MDH in 2008 (MDH 2008b). The MDH study also documented which types o f point-of-use carbon filters are effective at removing PFCs from drinking water. Using adsorption factors developed by 3M for a similar GAC system installed at their Cottage Grove plant, the predicted breakthrough time for each filter can be calculated based on the influent concentration and an assumed water use rate o f 300 gallons per day. M DH and MPCA staff use a tracking system to monitor water use at each home, and have collected multiple samples to monitor system performance. At average water use, the filters are predicted to last for years in some cases before maintenance is needed. The MPCA has determined that the filters will be changed according to a predictable, conservative schedule in order to ensure they operate effectively. The length o f time local residents were exposed to PFCs through their drinking water is unknown. As discussed above, exposures could have started soon after PFCs wastes were placed in the disposal sites, given the mobility o f PFCs in the environment. It is also possible that the levels in the groundwater were higher than currently detected, although it is impossible to determine what the concentrations may have been in the past or how long those higher concentrations may have lasted. Continued routine monitoring o f select private wells with levels o f PFCs below HRLs or the PFBA HBV will ensure that i f levels o f PFCs rise, future exposure to levels above health-based exposure limits will be brief. Exposure through Public Water Supplies The community wells in the affected area were sampled for PFCs by MDH on a monthly basis through 2007, and are now sampled on a quarterly basis, and the results of monitoring are reported to the city staff. While not required under the federal Safe Drinking Water Act, some cities report PFC results in their annual "Consumer Confidence Report" to their water customers. MDH will continue to monitor the wells, but to date very little change (other than perhaps a slight declining trend) has been observed in PFC levels in the community wells. N o individual community wells in the affected area have exceeded current MDH healthbased exposure limits for PFCs, except in the City o f Oakdale. This is described in a previous MDH report (MDH 2008a). 28 p. 54 Exposure through other Pathways The use o f water contaminated with low levels o f PFCs for bathing, showering, or other incidental uses is unlikely to contribute appreciably to overall exposure, ingestion o f the contaminated water is by far the predominant exposure pathway. Use o f PFC contaminated water for canning or cooking purposes may also contribute to exposure, as reported by Emmett et al. (2006a) and Holzer et al (2008). Irrigation o f plants with PFC contaminated water may possibly lead to some uptake o f PFCs by the plants, also contributing to overall exposure. So-called "market basket" studies o f food products occasionally show low levels o f PFCs. In a study conducted in the United Kingdom, PFOS was found at low concentrations in potatoes, some canned vegetables, eggs, and in the sugars and preserves food groups, while PFOA was detected only in potatoes (UK Food Standards Agency 2006). A similar study in Spain found low levels o f PFOS in fish, dairy products, and meat, while PFOA was only detected in milk (Ericson et al 2008). A recent study o f food items in Canada also found low levels o f PFOS and PFOA in some food products, including beef, fish, and microwave popcorn (Tittlemier et al. 2007). It is less likely that PFBA would be taken up by plants, but data are not available. The specific sources o f exposure to PFOS, PFOA, and other perfluorochemicals in the general population are unclear, but could include consumer products, environmental exposures, or other occupational exposures (Butenhoff et al. 2006). Both PFOS and PFOA have been detected in samples o f household dust collected from vacuum cleaner bags in Japan (Moriwaki et al. 2003), Canada (Kubwabo et al. 2005), and the U.S. (Stiynar and Lindstrom 2008), indicating the indoor environment is one potential source o f exposure. Low ppt levels o f PFOS have also been detected in rainwater collected in Winnipeg, Canada (Loewen et al. 2005). Small amounts o f unbound fluorotelomer alcohols that can break down to PFOS or PFOA (or other PFCs depending on their specific composition; also referred to as PFC precursors) have also been found in consumer and industrial products (Joyce et al. 2006). Release o f telomer alcohols, and subsequent degradation in the environment or by organisms, could also be a source o f human exposure to PFCs. One recent study estimated that, for some individuals, PFC precursor-based exposure could contribute up to 60-80% o f total PFOS and 28-55% o f total PFOA exposure (Vestergren et al 2008). Public Health Implications of PFC Exposure This section will briefly summarize current information on the toxicity o f PFCs to animals and humans, and summarize the public health implications o f exposure to PFCs through drinking water in affected communities in south Washington County, Minnesota. Note: ATSDR published a draft "Toxicological Profile for Perfluoroalkyl Compounds" for public review and comment in May 2009 (available at http://wvvw.atsdr.cdc.gov/toxprofi les/tp200. html#bookmark041. The Toxicological Profile reviews much o f the information below, as does a report by Lau et al (2007). 29 p. 55 Summary o f Toxicological Information MDH has previously summarized the available toxicological information on PFOS and PFOA in its Health Consultation on the 3M-Cottage Grove Facility (MDH 2005), and more recently in the Public Health Assessment regarding PFC contamination in Lake Elmo and Oakdale published in August 2008 (MDH 2008a). This section will only briefly summarize that information and will also describe available information on the toxicity o f PFBA. PFOS is well absorbed orally, but is not absorbed well through inhalation or dermal contact (OECD 2002). Half-lives o f PFOS have been estimated at over 100 days in rats in a single-dose study, and 200 days in a sub-chronic dosing study in cynomolgus monkeys (OECD 2002). Animal studies have shown that PFOA and APFO (its ammonium salt) are easily absorbed through ingestion, inhalation, and dermal contact (EPA 2002; Kennedy 1985; Kennedy et al. 1986; Kudo and Kawashima 2003). The estimated half-life o f PFOA in animals ranges from four hours in female rats and nine days in male rats to 20 days in male cynomolgus monkeys (Kudo and Kawashima 2003; Butenhoff et al. 2004). The mean blood serum half-life o f PFOA in humans was estimated to be 3.8 years in a published study o f 26 retired 3M workers, and the mean serum half-life o f PFOS was estimated at 5.4 years (Olsen et al. 2007a). The mean serum half-life o f PFHxS has been reported as 8.5 years. This indicates that some PFCs are retained in the human body for a much longer period than in mice, rats, or monkeys, and that carbon chain length is not necessarily directly related to half-life in humans. PFCs are not metabolized, and are excreted in the urine and feces at different rates in various test animal species and humans. Exposure to high levels o f PFOA, PFOS, and PFBA is acutely toxic in test animals (Kudo and Kawashima 2003; OECD 2002; Takagi et al. 1991). Chronic or sub-chronic exposure to lower doses o f PFOA in rats typically results in reductions in body weight and weight gain, and in liver effects such as an increase in liver weight and alterations in lipid metabolism (Kudo and Kawashima 2003). Immune system effects have also been reported in mice exposed to high doses o f PFOA (DeWitt et al 2008). The liver appears to be the primary target organ o f PFOA toxicity in rats, although effects on the kidneys, pancreas, testes, and ovaries have also been observed (EPA 2002). Exposure to PFOA (and other PFCs) in rats results in a phenomenon in the liver known as peroxisome proliferation. This phenomenon is considered to be limited to rats and similar test animals, and is not observed in primates. Some o f the adverse liver effects observed in rats such as an increase in liver weight are in part attributed to peroxisome proliferation. Adverse liver effects in primates are likely the result o f a different mode o f action. Chronic exposure to PFOS at high doses results in liver toxicity and mortality, with a steep dose-response curve for mortality in rats and primates (OECD 2002). Indications of toxicity observed in 90-day rat studies include increases in liver enzymes and other adverse liver effects, gastrointestinal effects, blood abnormalities, weight loss, convulsions, and death. Immunotoxicity has also been reported in studies conducted in mice at relatively low doses (Peden-Adams et al. 2008). 30 p. 56 Som e long-term animal studies suggest that exposure to PFOA could increase the risk o f tumors o f the liver, pancreas, and testes (Kudo and Kawashima 2003, EPA 2002, OECD 2002). The mechanism o f potential carcinogenesis is unclear, but evidence suggests that the tumors are the result o f tumor promotion (via oxidative stress, cell death, or hormonemediated mechanisms) and not from direct damage to the genetic material within cells (genotoxicity). The tumors observed in rats may be a result o f peroxisome proliferation, and may not be o f relevance in humans (Kennedy et al. 2004). Various reproductive studies o f rats followed for two generations showed postnatal deaths and other developmental effects in offspring o f female rats exposed to relatively low doses of PFOS and APFO (EPA 2002, OECD 2002). These studies demonstrate that exposure to APFO/PFOA and PFOS can result in adverse effects on the offspring o f rats exposed while pregnant. PFBA has not been studied as extensively as PFOA or PFOS, and until 2008 MDH lacked necessary information to derive a HBV for it. Like other PFCs, PFBA has been demonstrated to cause peroxisome proliferation in the livers o f rats exposed through their diet or by intraperitoneal injection (Ikeda et al. 1985; Takagi et al. 1991). The effects o f treatment with PFBA were less severe than was observed with PFOA in these two studies. Similar effects have been seen in mouse studies (Permadi et al. 1992). In a similar study comparing the effects o f PFOA and PFBA on rat livers, Just et al. (1989) found that the effects o f treatment with PFBA were similar to that o f PFOA for some parameters measured in the study. A key question MDH considered in the development o f the 2008 HBV for PFBA was its half-life in animals and humans. Chang et al. (2007) summarized data from a study o f the pharmacokinetics o f PFBA in several animal species. The study showed that PFBA was eliminated quickly through urine in male and female rats, with a half-life o f approximately 8 hours in male rats and less than two hours in female rats. The half-life in monkeys was less than two days. In study published in 2008, the mean half-life o f PFBA in four male employees at the 3M-Cottage Grove plant and seven male and three female employees at the 3M-Cordova, Illinois plant was calculated to be 72 hours in males and 87 hours in females (Chang et al. 2008). A 28-day oral toxicity study o f PFBA in rats (Lieder et al. 2007) showed that male rats exposed to PFBA had increased liver weights and decreased cholesterol, and other minor effects that went away once the exposure was stopped. In this study, some rats were also exposed separately to PFOA as a positive control. The main differences between male rats given PFBA and PFOA were that PFBA treated rats did not have lower body weights, but did have lower cholesterol. PFOA exposed rats did have a reduction in body weight, exhibited less physical activity and overall health, and had slight reductions in parameters related to red blood cells. The findings o f a developmental study o f PFBA in mice conducted at the EPA laboratory in North Carolina was also reviewed by MDH (Das et al. 2007). In the study, exposure to PFBA by pregnant mice did not appear to significantly affect maternal weight gain or 31 p. 57 fertility. Some developmental delays were observed in the offspring o f the mice, and developmental effects were considered a co-critical effect along with liver, blood and thyroid effects in establishing the HBV for PFBA. N o animal studies regarding exposure to multiple PFCs at the same time have been located in the scientific literature. The current MDH HRLs for PFOS and PFOA are based on toxicological studies conducted on Cynomolgus monkeys. In the case o f PFOS, the key study was used to derive a toxicity value (known as a reference dose, or RfD) o f 0.000075 milligrams per kilogram-day (mg/kg-d). The RfD included a `dose metric adjustment' o f 20 to account for the large difference in half-life between Cynomolgus monkeys (110-132 days) and humans (5.4 years), as well as a total uncertainty factor (used to account for various uncertainties in applying animal studies to humans, among other factors) o f 100. The critical effects used to determine the RfD were a decrease in serum high-density lipoprotein (i.e. "good" cholesterol) and thyroid hormones. For PFOA, the key study was used to derive an RfD o f 0.00014 mg/kg-d. The RfD for PFOA included a `dose metric adjustment' o f 70 to account for the even larger relative difference in half-life between Cynomolgus monkeys (20 days) and humans (3.8 years), as well as a total uncertainty factor o f 300. The critical effect used to determine the RfD was an increase in relative liver weight. The 2008 HBV for PFBA is based on toxicological studies conducted on rats. Several different HBVs based on different exposure periods (short-term, sub-chronic, and chronic) were derived based on more recent MDH practices. The lowest value, which in the case o f PFBA is the short-term value, became the final HBV for all three exposure periods. For this value, a reference dose o f 0.0038 mg/kg-d was derived from the key study, which included a much smaller `dose metric adjustment' o f eight due to the much shorter mean half-life o f PFBA in humans (3 days) versus rats (9.22 hours). The total uncertainty factor was 100. Summary o f Human Exposure Information PFCs, primarily PFOS and PFOA, have been detected in the blood o f U.S. citizens in multiple studies (Olsen et al 2003, 2004a, and 2004b). PFCs have also been shown to cross the placenta. In a study o f fifteen pairs o f maternal and cord blood samples in Japan, Inoue et al. (2004) detected PFOS in the cord blood samples at approximately onethird the concentration in maternal blood. PFOA was detected in maternal blood, but not in cord blood. A similar study o f 11 paired maternal and cord blood samples collected in Germany showed PFOS in cord blood at approximately 60% o f the maternal blood concentration (Midasch et al. 2007). This study did detect low levels o f PFOA (median o f 3.4 fig/L) in cord blood samples, slightly above that found in the maternal blood samples. A larger study conducted in the city o f Baltimore measured ten PFCs in the cord serum o f 299 newborns (Apelberg et al. 2007a). PFOS and PFOA were detected in nearly all o f the samples, at a geometric mean level o f 4.9 and 1.6 ppb, respectively. Other PFCs were detected much less frequently, and at lower levels. In a follow-up study (Apelberg 2007b), a small (sub-clinical) negative association between both PFOA and PFOS cord 32 serum concentration and birth weight and size was observed. A similar study conducted in Denmark showed an inverse correlation between maternal serum PFOA levels and birth weight (Fei et al. 2007). The most comprehensive data on PFC levels in the blood o f the U.S. population has been produced by the Center for Disease Control and Prevention's (CDC) National Health and Nutrition Examination Survey (NHANES) as reported by Calafat et al. (2007a and 2007b). Blood serum data (PFOS, PFOA, PFHxS) have been reported for several thousand people, age 12 and above, for the survey years 1999-2000, and 2003-2004, as shown in the table below. Geometric mean data for PFCs, U.S. population, in ppb Survey Year PFOS PFOA 1999-2000 30.4 5.2 2003-2004 20.7 3.9 PFHxS 2.1 1.9 The data suggest that PFC levels in the blood serum o f the general population are declining, perhaps due to a reduction in the use o f PFCs in consumer products. Many other PFCs were included in the NHANES sample analysis, but data are not presented here because the PFCs were below detection limits, or only sporadically detected. PFBA was not included in the NHANES analyses. Information on PFC levels in Washington County residents exposed to PFCs through drinking water has been collected through a biomonitoring pilot program created and funded by the Minnesota Legislature in 2007 (MDH 2009). For the pilot study, health scientists interviewed and obtained blood samples from 196 randomly selected adult participants in order to measure the levels o f seven PFCs in their blood. One half o f the participants' homes were served by private wells in Lake Elmo and Cottage Grove and the other half were served by th Oakdale municipal water system. The private wells had to have at least trace levels (0.1 ppb or greater) o f PFOA or PFOS for the residents to be eligible for the study. The geometric mean results for the 196 participants were as follows: Geometric mean data for PFCs, MDH Biomonitoring Pilot Study, in ppb Survey Year PFOS PFOA PFHxS 2008-2009 35.9 15.4 8.4 PFBA was detected in 55 (28%) of the 196 serum samples collected from the project population (PFBA level o f detection (LOD) was 0.1 ppb), with a maximum detected value o f 8.5 ppb. PFBS was detected in 5 (3%) o f the 196 serum samples collected from the population (PFBS LOD was 0.1 ppb). With so many o f the samples measuring below the level o f detection, an accurate geometric mean or other measure o f central tendency could not be calculated. PFPeA and PFHxA were not detected in any o f the 196 serum samples collected. 33 p. 59 Overall, the pilot biomonitoring showed that the levels o f three PFCs were high: in east metro residents than in the U.S. population as a whole. There was little difference between the Oakdale and Lake Elmo/Cottage Grove participants. Individual results were mailed to those participants who indicated they wished to receive them. Participants also received other helpful information about national findings for PFCs in people's blood, PFCs in general, and ways to reduce exposure to PFCs. MDH may re-examine this population in a few years to determine if blood levels o f PFCs fall, now that exposures through drinking water have ended for the most part. The largest investigation o f human exposure to PFOA is taking place in the Ohio-West Virginia area, and grew out o f a court settlement o f a class action lawsuit against the DuPont Corporation in 2005. This investigation is known as the C8 Health Project, and information on it can be found on the project's web site, http://www.hsc.wvu.edu/som/cmed/c8/. The project has enrolled 69,030 people who may have been exposed to PFOA through drinking water. The participants have been tested for PFOA (and some other PFC) exposure through analysis o f blood samples. The project will also involve ten separate studies to help determine whether PFOA exposure is associated with any observable human health effects. Eight o f the studies will focus on diseases such as cancer, heart disease, stroke, diabetes, immune function, liver and hormone disorders, and birth outcomes. Two studies will look at exposure to PFOA and its half-life in the general population. The studies are estimated to be complete in several years, although some preliminary results have been posted on the study's web site. Details o f the studies and results can be found on the C8 Science Panel web site at http://www.c8sciencepanel.org/mdex.html. Selected preliminary results from die project were described in 2008 in a presentation at the West Virginia University School of Medicine (Frisbee 2008). The preliminary results described possible associations between PFOA exposure and indicators o f inflammation, immune, liver, and thyroid function, and cholesterol that are consistent with some animal studies. The State o f West Virginia examined cancer rates in three counties near the West Virginia DuPont PFOA plant (Colsher et al. 2005). The study found that some tumors that may be associated with PFOA exposure in animal studies were elevated in some parts o f the study area, but that the reported cancers could not be directly related to PFOA exposure through drinking water. Also, other chemical exposures were known to exist in the area. Discussion o f the Public Health Implications o f PFC Exposure Blood levels o f PFCs observed in the east metro area are well below levels o f departure in animals used to calculate MDH HRLs (23 parts per million (ppm) for PFOA, 35 ppm for PFOS; MDH 2007 a and 2007b). The level o f departure is the serum level in an animal at which critical adverse health effects are observed. Blood levels are also well below levels measured in 3M-Cottage Grove plant workers (PFOA, geometric mean 850 ppb; PFOS, geometric mean 440 ppb; 3M 2003c). Some studies o f 3M workers have not observed reproducible or consistent health effects (i.e. Alexander et al 2003); a more recent study by Lundin et al (2009) did suggest positive associations between PFOA exposure and prostate cancer, cerebrovascular disease, and diabetes in 3M-Cottage Grove 34 workers. MDH is closely following the ongoing 3M workforce studies, as well as the West Virginia study, which will provide more definitive information about the health implications o f PFC exposure in the east metro area. On January 8,2009, the U.S. EPA's Office o f Water issued Provisional Health Advisories for PFOS and PFOA o f 0.2 and 0.4 ppb, respectively (EPA 2009). This action was taken in response to a situation in Alabama where it was found that sludge from a wastewater treatment plant that received PFC contaminated industrial wastewater had been land-applied. The sludge is believed to be responsible for low levels o f PFOA found in nearby community waiter systems. The 2009 EPA Provisional Health Advisory values are very close to MDH's HRLs for PFOS and PFOA, but were calculated in a slightly different way. MDH has determined that if the EPA values were applied in situations where drinking water is contaminated with PFOS or PFOA, no additional well advisories or other health-protection actions would be necessary. M DH's health-based exposure limits are protective for all segments o f the population, including vulnerable sub-populations. Nevertheless, those who may be especially concerned with their continued exposure to low levels o f PFCs through drinking water (even at levels below MDH HRLs or HBVs), such as pregnant women or parents with infants, can take additional steps to reduce exposure by using bottled water for drinking, cooking, or making formula, or by using point o f use filters to treat water used for these purposes. MDH recently completed a study o f the effectiveness o f point o f use water treatment devices for PFCs which demonstrated that reverse-osmosis and activated carbon filters work well under both laboratory and real-world conditions (MDH 2008b). Health Outcome Data Review On June 7, 2007 the Minnesota Cancer Surveillance System (MCSS), located within the Chronic Disease and Environmental Epidemiology Section o f MDH issued a report presenting detailed profiles o f cancer rates among residents o f Dakota and Washington Counties (MDH 2007c). Using MCSS data for the 15-year period 1988-2002, county wide cancer rates for all cancers combined and for each o f about 25 o f the most frequent types o f cancer, including liver and thyroid cancer were examined. In addition, analyses were also conducted to examine incidence rates for 16 selected cancers for specific communities, by zip code, within each county. For that analysis, data from the years 1996-2004 were used, largely due to population growth in some communities and limitations on community census data. The report (which can be accessed at the MDH web site, www.health.state.mn.us/1 found that overall cancer rates in Washington and Dakota counties are very similar to the rest o f the state, or slightly lower. In addition, the rates and types o f cancers that occurred within specific communities in the two counties were generally similar with other communities in the Twin Cities metropolitan area. 35 Analyses o f community cancer rates are rarely useful for evaluating potential cancer risks from low levels o f environmental pollutants. Nevertheless, such data can be helpful in addressing public concerns over cancer rates in a county or a community. The reader is referred to the full report for a more detailed description o f the benefits and limitations o f the analysis. Child Health Considerations MDH recognizes that the unique vulnerabilities o f infants and children are o f special concern to communities faced with contamination o f their water, soil, air, or food. Children are at a greater risk than adults are from certain kinds o f exposures to environmental contaminants at waste disposal sites. They are more likely to be exposed because they often play outdoors and bring food into contaminated areas. Children are smaller than adults, which means children breathe dust and heavy vapors that are close to the ground; and children receive higher doses o f chemical exposure per body weight. The developing body systems o f children can sustain permanent damage if toxic exposures occur during critical growth stages. Most importantly, children depend completely on adults for risk-identification and risk-management decisions, housing decisions, and for access to medical care. Children have been exposed to low levels o f PFCs in contaminated drinking water in the communities described in this report. MDH health-based exposure limits are calculated with protection o f children's health in mind. A s stated previously, those who may be especially concerned with children's exposure to low levels o f PFCs through drinking water, such as pregnant women or parents with infants, can take additional steps to reduce exposure by using bottled water for drinking, cooking, or making formula, or by using point o f use filters to treat water used for these purposes. Conclusions PFC-containing wastes were disposed o f by 3M in land disposal sites in Oakdale, Lake Elmo, and Woodbury, Minnesota. PFCs were released to groundwater from these sites, possibly shortly after the disposal occurred, resulting in contamination o f nearby drinking water wells. The levels o f PFCs in drinking water in the past are unknown and in the past exposure could have occurred through drinking water, possible air emissions during the handling, disposal, or burning o f waste or direct contact with the waste. A pilot biomonitoring study conducted in Oakdale, Lake Elmo, and Cottage Grove indicated levels o f PFCs in resident's blood that are above national averages. While available evidence suggests that these PFC levels are unlikely to cause adverse health effects, there is no information available regarding PFC levels in resident's blood or in drinking water in the past. MDH cannot conclude whether drinking or breathing PFCs in water or air or contact with PFC-containing wastes in the past harmed people's health. 36 Currently, PFCs have been detected in public and private wells across a wide area o f south Washington County, and in parts o f northern Dakota County and southeastern Ramsey County. Exposure to PFCs at levels above health concern is currently being addressed by the use o f bottled water or whole-house activated carbon filters at homes that have been issued a drinking water well advisory by MDH. MDH concludes that currently, drinking water from public or private wells that contain PFCs is not expected to harm people's health; new data will be evaluated as it becomes available. Remediation actions to address PFCs at the waste disposal sites are underway by 3M and the MPCA. Recommendations 1. 3M should continue to follow the requirements o f the Consent Order to implement the selected remediation options for soil and groundwater at the 3MWoodbury Disposal Site. 2. People should avoid trespassing on the 3M-Woodbury Disposal Site, especially during remediation activities. 3. Extensions o f the Cottage Grove municipal water supply to serve areas where private wells contain levels o f PFCs in excess o f MDH HRLs or HBVs should be considered. 4. Monitoring o f selected private wells in the affected area should continue under agreed upon sampling plans to track changes in the plume and monitor for changes in concentration in individual wells. If the plume remains stable, the frequency and number o f wells monitored may be reduced while still providing assurance that public health is protected. 5. 3M should ensure the monitoring network at the disposal site provides adequate information regarding water quality in the "high transmissivity zone" o f the Prairie du Chien aquifer. Public Health Action Plan The MDH Public Health Action Plan for the site includes the following; 1) distribution o f this public health assessment (and/or an information sheet summarizing the information contained in this public health assessment) to area residents; 2) continued consultation with the MPCA, 3M, Washington County, and the affected communities on implementing investigation and response-action activities and the recommendations provided in the Recommendations section o f this document; 3) continued outreach to private-well owners; 4) continued monitoring o f public water supplies; 5) organization and participation in public meetings and meetings with local government officials as needed, 6) evaluation o f other potential pathways for environmental exposure to PFCs, and consideration o f additional biomonitoring studies to evaluate PFC levels in area residents exposed to PFOA and PFOS in drinking water. 37 p. 63 References 3M 2003a. Environmental and Health Assessment o f Perfluorooctane Sulfonate Acid and its Salts. 3M Company, St. Paul, Minnesota. August 20, 2003. 3M 2003b. Letter from Michael A. Santoro, 3M, and George H. Millet, 3M, to the U.S. EPA Office o f Pollution Prevention and Toxics. August 1,2003. 3M 2003c. Assessment o f Lipid, Hepatic, and Thyroid Function in Relation to an Occupational Biologic Limit Value for Perfluorooctanoate. Medical Department, 3M Company, St. Paul, Minnesota 55144. June 9, 2003. 3M 2008. Letter from Katie Winogrodzki, 3M, to Gerald Stahnke, MPCA. September 19, 2008. Alexander, B.H., Olsen, G.W., Burris, J.M., Mandel, J.H., and Mandel, J.S. Mortality o f employees o f a perfluorooctanesulphonyl fluoride manufacturing facility. Occupational and Environmental Medicine 60: 722-729. Alexander, C. 2007. Fractured sandstone karst aquifers, the S t Peter, Jordan and Hinckley Formations: Examples for Askov, Woodbury, Rochester and Elsewhere. Presented at the Minnesota Groundwater Association spring conference, April 19, 2007, Apelberg, B.J., Goldman, L.R., Calafat, A.M., Herbstman, J.B., Kuklenyik, Z., Heidler, J., Needham, L.L., Halden, R.U., and Witter, F.R. 2007a. Determinants o f fetal exposure to polyfluoroalkyl compounds in Baltimore, Maryland. Environmental Science and Technology 41: 3891-3897. Apelberg, B.J., Witter, F.R., Herbstman, J.B., Calafat, A.M., Halden, R.U., Needham, L.L., and Goldman, L.R., 2007b. Cord serum concentrations o f perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) in relation to weight and size at birth. Environmental Health Perspectives 115: 1670-1676. ATSDR 2009. Draft Toxicological Profile for Perfluoroalkyl Acids. Agency for Toxic Substances and Disease Registry, Atlanta GA. May 2009. Brezinski, D. 2003. Laying the Foundation for New Technologies: 3M Creates a new building block for its fluorosurfactants. Paint & Coatings Industry, January 2003. Butenhoff J.L., Kennedy G.L., Hinderliter P.M., Lieder P.H., Jung R., Hansen K.J., Gorman G.S., Noker P.E., Thomford P.J. 2004. Pharmacokinetics o f perfluorooctanoate in cynomolgus monkeys. Toxicological Sciences 82: 394-406. Butenhoff, J.L., Olsen, G.W., and Pfahles-Hutchens, A. 2006. The applicability o f biomonitoring data for perfluorooctanesulfonate to the environmental public health continuum. Environmental Health Perspectives 114: 1776-1782. 38 Calafat, A.M., Kuklenyik, Z., Reidy, J.A., Caudill, S., Tully, J.S., and Needham, L.L. 2007a. Serum concentrations o f 11 polyfluoroalkyl compounds in the U.S. population: data from the National Health and Nutrition Examination Survey (NHANES) 1999-2000. Environmental Science and Technology 41: 2237-2242. Calafat, A.M., Wong, L-Y., Kuklenyik, Z., Reidy, J.A., and Needham, L.L. 2007b. Polyfluoroalkyl chemicals in the U.S. population: data from the National Health and Nutrition Examination Survey (NHANES) 2003-2004 and comparisons to NHANES 1999-2000. Environmental Health Perspectives 115: 1596-1602. Chang, S., Hart, J., Ehresman, D., Das, K., Lau, C., Noker, P., Gorman, G., Tan, Y., and Butenhoff, J. 2007. The pharmacokinetics o f perfluorobutyrate (PFBA) in rats, mice, and monkeys. The Toxicologist, Supplement to Toxicological Sciences 96: abstract 937. Chang, S,, Das, K., Ehresman, D.J., Ellefson, M.E., Gorman, G.S., Hart, J.A., Nokers, P.E., Tan, Y.M., Lieder, P.H., Lau, C., Olsen, G.W., and Butenhoff, J.L. 2008. Comparative pharmacokinetics o f perfluorobutyrate in rats, mice, monkeys, and humans and relevance to human exposure via drinking water. Toxicological Sciences 104: 40-53. Colsher, P., Ducatman, A., and Haddy, L. Examination o f community concerns about water contamination with perfluorooctanoic acid and related chemicals using populationbased cancer registry data. West Virginia Department o f Health and Human Services, Charleston, W.V. 2005. Conder, J.M., Hoke, R.A., De Wolf, W., Russell, M.H., and Buck, R.C. 2008, Are PFCAs bioaccumulative? A critical review and comparison with regulatory criteria and persistent lipophilic compounds. Environmental Science and Technology 42: 995-1003. Das, K.P., Grey, B., Butenhoff, J., Tanaka, S., Ehresman, D., Zehr, D., Wood, C., and Lau, C. 2007. Effects o f perfluorobutyrate exposure in mice during pregnancy. Toxicological Sciences, advance published May 28, 2008. D e Silva, A.O., and Mabury, S.A. 2006. Isomer distribution o f perfluorocarboxylates in human blood: potential correlation to source. Environmental Science and Technology 40: 2903-2909. DeWitt, J.C., Copeland, C.B., Strynar, M.J., and Luebke, R.W. 2008. Perfluorooctanoic acid-induced immunomodulation in adult C57BL/6J or C57BL/6N female mice. Environmental Health Perspectives 116: 644-650. Delta (2008) Perfluorocarbon (PFC)-Containing Firefighting Foams and Their Use in Firefighting Training in Minnesota. Prepared for Minnesota Pollution Control Agency. June 30, 2008. 39 Emmett, E.A., Shofer, F.S., Zhang, H., Freeman, D., Desai, C., and Shaw, L.M. 2006a. Community exposure to perfluorooctanoate: relationships between serum concentrations and exposure sources. Journal o f Occupational and Environmental Medicine 48: 759-770. Emmett, E.A., Zhang, H., Shofer, F.S., Freeman, D., Rodway, N.V., Desai, C., and Shaw, L.M. 2006b. Community exposure to perfluorooctanoate: relationships between serum levels and certain health parameters. Journal o f Occupational and Environmental Medicine 48: 771-779. EPA 2002. Revised Draft Hazard Assessment o f Perflourooctanoic Acid and its Salts. U.S. Environmental Protection Agency, Office o f Pollution Prevention and Toxics. November 4, 2002. EPA 2003. Preliminary Risk Assessment o f the Developmental Toxicity Associated with Exposure to Perflourooctanoic Acid and its Salts. U.S. Environmental Protection Agency, Office o f Pollution Prevention and Toxics. April 10,2003. EPA 2006. 2010/15 PFOA Stewardship Program. U.S. Environmental Protection Agency, Washington, D.C. Accessed May 23, 2007 at http://www.eDa.gov/opptintr/pfoa/pubs/pfoastewardship.htm EPA 2009. Provisional Health Advisories for Perfluorooctanoic Acid (PFOA) and Perfluorooctane Sulfonate (PFOS). U.S. Environmental Protection Agency, Office of Water, Washington, D.C. January 8, 2009. Ericson, I., Marti-Cid, R., Nadal, M., Van Bavel, B., Lindstrom, G., and Domingo, J.L. 2008. Human exposure to perfluorinated chemicals through the diet: intake o f perfluorinated compounds in foods from the Catalan (Spain) market. Journal o f Agricultural and Food Chemistry 56: 1787-1794. Fei, C., McLaughlin, J.K., Tarone, R.E., and Olsen, J. 2007. Perfluorinated chemicals and fetal growth: a study within the Danish national birth cohort. Environmental Health Perspectives 115: 1677-1682. Flury, M. and Wai, N.N. 2003. Dyes as tracers for vadose zone hydrology. Review o f Geophysics 41:1002-1005. Frisbee, S.J. 2008. The C8 Health Project: how a class action lawsuit can interact with public health - history o f events. Presentation at the West Virginia University School o f Medicine, May 7, 2008. Accessed online at: http://www.hsc.wvu.edu/som/cmed/ophp/pdfs/Public%20Health%20Grand%20Rounds% 2005-07-2008%20-%20C8%20Health%20Project.pdf Higgins, C.P., and Luthy R.G. 2006. Sorption o f perfluorinated surfactants on sediments. Environmental Science and Technology 40: 7251 -7256. 40 Holzer, J., Midasch, O., Rauchfuss, K., Kraft, M., Reupert, R., Angerer, J., Kleeschulte, P., Marschall, N., and Wilhelm, M. 2008. Biomonitoring o f perfluorinated compounds in children and adults exposed to perfluorooctanoate-contaminated drinking water. Environmental Health Perspectives 116: 651-657. Ikeda, T., Aiba, K., Fukuda, K., and Tanaka, M. 1985. The induction o f peroxisome proliferation in rat liver by perfluorinated fatty acids, metabolically inert derivatives o f fatty acids. Journal o f Biochemistry 98: 475-482. Inoue, K., Okada, F., Ito, R., Kato, S., Sasaki, S., Nakajima, S., Uno, A., Saijo, Y., Sata, F., Yoshimura, Y., Kishi, R., and Nakazawa, H. 2004. Perfluorooctane sulfonate (PFOS) and related perfluorinated compounds in human maternal and cord blood samples: assessment o f PFOA exposure in susceptible population during pregnancy. Environmental Health Perspectives 112: 1204-1207. Joyce, M., Dinglasan-Panlilio, A., and Mabury, S.A. 2006. Significant residual fluorinated alcohols present in various fluorinated materials. Environmental Science and Technology 40: 1447-1453. Just, W.W., Gorgas, K., Haiti, F.U., Heinemann, P., Salzer, M., and Schmissek, H. 1989. Biochemical effects and zonal heterogeneity o f peroxisome proliferation induced by perfluorocarboxylic acids in rat liver. Hepatology 9: 570-581. Kanivetsky R. and Cleland, J. M. 1990. Hydrogeology, in: Geologic Atlas o f Washington County, Minnesota. Minnesota Geological Survey; County Atlas Series, Atlas C-5, Plate 5. Karrman, A., Ericson, I., van Bavel, B., Damerud, P.O., Aune, M., Glynn, A., Lignell, S., and Lindstrom, G. 2007. Exposure o f perfluorinated chemicals through lactation: levels in matched human milk and serum and a temporal trend, 1996-2004, in Sweden. Environmental Health Perspectives 115: 226-230. Kauck, E.A. and Diesslin, A.R. 1951. Some properties o f perfluorocarboxylic acids. Industrial and Engineering Chemistry 43: 2332-2334. Kennedy, G.L. 1985. Dermal toxicity o f ammonium perfluorooctanoate. Toxicology and Applied Pharmacology 81: 348-355. Kennedy, G.L., Hall, G.T., Britelli, M.R., Barnes, J.R., and Chen, H.C. 1986. Inhalation toxicity o f ammonium perfluorooctanoate. Food Chemistry and Toxicology 24: 13251329. Kennedy, G.L., Butenhoff, J.L., Olsen, G.W., O'Connor, J.C., Seacat, A.M., Perkins, R.G., Biegel, L.B., Murphy, S.R., and Farrar, D.G. 2004. The toxicology o f perfluorooctanoate. Critical Reviews in Toxicology 34: 351-384. 41 p. 67 Kubwabo, C., Stewart, B., Zhu, J., and Marro, L. 2005. Occurrence o f perfluorosulfonates and other perfluorochemicals in dust from selected homes in the city o f Ottawa, Canada. Journal o f Environmental Monitoring 7: 1074-1078. Kudo, N. and Kawashima, Y. 2003. Toxicity and toxicokinetics o f perfluorooctanoic acid in humans and animals. The Journal o f Toxicological Sciences 28: 49-57. Kwan, W.C. 2001. Physical Property Determination o f Perfluorinated Surfactants (doctoral thesis). University o f Toronto, Graduate Department o f Chemistry. Lau, C., Anitole, K., Hodes, C., Lai, D., Pfahles-Hutchens, A., and Seed, J. 2007. Perfluoroalkyl acids: a review o f monitoring and toxicological findings. Toxicological Sciences 99: 366-394. Lieder, P.H., Tanaka, S., Ehresman, D.J., Roy, R.R., Otterdijk, F., and Butenhoff, J.L. 2007. A 28-day oral (gavage) toxicity study o f ammonium perfluorobutyrate (A PFB ).. The Toxicologist, Supplement to Toxicological Sciences 96: abstract 931. Lindholm, G.F., Helgesen, J.O., Broussard, W.L., and Farrell, D.F. 1974. Water Resources o f the Lower St. Croix River Watershed, East-Central Minnesota. Hydrologic Investigations Atlas HA-490; U.S. Geological Survey, Reston, VA. Loewen, M., Halldorson, T., Wang, F., and Tomy, G. 2005. Fluorotelomer carboxylic acids and PFOS in rainwater from an urban center in Canada. Environmental Science and Technology 39: 2944-2951. Lundin, J.I., Alexander, B.H., Olsen, G.W., and Church, T. R. 2009. Ammonium perfluorooctanoate production and occupational mortality. Epidemiology 20: 921-928. MDH 2005. Health Consultation on Perfluorochemical Releases at the 3M Cottage Grove Facility. Minnesota Department o f Health, St. Paul, Minnesota, February 18, 2005. MDH 2007a. Health Based Values for Perfluorooctanoic Acid. Memorandum from Helen Goeden, Health Risk Assessment Unit to John Stine, Environmental Health Division Director. Minnesota Department o f Health, St. Paul, Minnesota, February 26, 2007. MDH 2007b. Health Based Values for Perfluorooctane Sulfonate. Memorandum from Helen Goeden, Health Risk Assessment Unit to John Stine, Environmental Health Division Director. Minnesota Department o f Health, St. Paul, Minnesota, February 26, 2007. MDH 2007c. Cancer Incidence in Dakota and Washington Counties. MCSS Epidemiology Report 2007:1. Minnesota Cancer Surveillance System, Chronic Disease 42 p. 68 and Environmental Epidemiology Section, Minnesota Department o f Health, St. Paul, Minnesota. June 7, 2007. MDH 2008 a. Public Health Assessment on Perfluorochemical Contamination in Lake Elmo and Oakdale, Washington County, Minnesota. Minnesota Department o f Health, St. Paul, Minnesota, August 29, 2008. MDH 2008b. Performance Evaluation, Removal o f Perfluorochemicals (PFCs) with Point-of-Use (POU) Water Treatment Devices. Minnesota Department o f Health, St. Paul, Minnesota, May 1, 2008. MDH 2009. East Metro Perfluorochemical Biomonitoring Pilot Project Report. Minnesota Department o f Health, St. Paul, Minnesota, July 21, 2009. MGS, 1990. Geologic Atlas o f Washington County, Minnesota. County Atlas Series, Atlas C-5. Minnesota Geological Survey, University of Minnesota. 7 plates. Midasch, O., Drexler, H., Hart, N., Beckmann, M.W., and Angerer, J. 2007. Transplacental exposure o f neonates to perfluorooctanesulfonate and perfluorooctanoate: a pilot study. International Archives o f Occupational and Environmental Health, DOI 10.1007/s00420-006-0165-9. Minnesota Department of Administration 2009. Annual estimates of city and township population, households and persons per household, 2000 to 2008. Minnesota State Demographic Center. Accessed September 1,2009 online at http://www.demographv.state.mn.us/ Moriwaki, H., Takata, Y., and Arakawa, R. 2003. Concentrations o f perlfiiorooctane sulfonate (PFOS) and perfluorooctanoic acid (PFOA) in vacuum cleaner dust collected in Japanese homes. Journal o f Environmental Monitoring 5: 753-757. MPCA 2007a. Soil Reference Values (SRVs) for PFOA and PFOS. Memorandum from Emily Hansen, MPH to Kathryn Sather, May 8, 2007. MPCA 2007b. Surface Water Quality Criteria for Perfluorooctane Sulfonic Acid and Perfluorooctanoic Acid. August 2007. Accessed online at: http://w\vw.pca.state.nm.us/hot/pfc.html#pfos MPCA 2007c. Proposed Consent Order on PFCs: A Summary o f the Negotiations. Minnesota Pollution Control Agency, St. Paul, Minnesota. Accessed online at http://www.pca.state.mn.us/publications/pfc-consentorderfactsheet.pdf- MPCA 2007d. Settlement Agreement and Consent Order with 3M. Minnesota Pollution Control Agency, St. Paul, Minnesota. Accessed online at http://www.pca.state.mn.us/publications/pfc-3mchemolite-consent.pdf 43 p. 69 OECD 2002. Hazard Assessment o f Perfluorooctane Sulfonate (PFOS) and its Salts. Organization for Economic Cooperation and Development. November 21, 2002. Ohmori, K., Kudo, N., Katayama, K., and Kawashima, Y. 2003. Comparison o f the toxicokinetics between perfluorocarboxylic acids with different carbon chain length. Toxicology 84: 135-140. Olsen, G.W., Church, T.R., Miller, J.P., Burris, J.M., Hansen, K.J., Lundberg, J.K., Armitage, J.B., Herron, R.M., Medhdizadehkashi, Z., Nobiletti, J.B., O'Neill, E.M., Mandel, J.H., and Zobel, L.R. 2003. Perfluorooctanesulfonate and other fluorochemicals in the serum o f American Red Cross adult blood donors. Environmental Health Perspectives 111: 1892-1901. Olsen, G.W., Chinch, T.R., Hansen, K.J., Burris, J.M., Butenhoff, J.L., Mandel, J.H., and Zobel, L.R. 2004a. Quantitative evaluation o f perfluorooctanesulfonate (PFOS) and other fluorochemicals in the serum o f children. Journal o f Children's Health 2: 53-76. Olsen, G.W., Church, T.R., Larson, E.B., van Belle, G., Lundberg, J.K., Hansen, K.J., Burris, J.M., Mandel, J.H., and Zobel, L.R. 2004b. Serum concentrations o f perfluorooctanesulfonate and other fluorochemicals in an elderly population from Seattle, Washington. Chemosphere 54: 1599-1611. Olsen, G.W., Burris, J.M., Ehresman, D.J., Froehlich, J.W., Seacat, A.M., Butenhoff, J.L., and Zobel, L.R. 2007a. Half-life o f serum elimination o f perfluorooctanesulfonate, perfluorohexanesulfonate, and perfluorooctanoate in retired fluorochemical production workers. Environmental Health Perspectives 115: 1298-1305. Olsen, G.W., Mair, D.C., Reagan, W.K., Ellefson, M.E., Ehresman, D.J., Butenhoff, J.L., and Zobel, L. 2007b. Preliminary evidence o f a decline in perfluorooctanesulfonate (PFOS) and perfluorooctanoate (PFOA) concentrations in American Red Cross blood donors. Chemosphere 68: 105-111. Olsen, G.W., and Zobel, L.R. 2007. Assessment o f lipid, hepatic, and thyroid parameters with serum perfluorooctanoate (PFOA) concentrations in fluorochemical production workers. International Archives o f Occupational and Environmental Health 81: 231-246. Peden-Adams, M.M., Keller, J.M., EuDaly, J.G., Berger, J., Gilkeson, G.S., and Keil, D.E. 2008. Suppression o f humoral immunity in mice following exposure to perfluorooctane sulfonate (PFOS). Toxicological Sciences, advance published March 20, 2008. Permadi, H., Lundgren, B., Andersson, K , and DePierre, J.W. 1992. Effects o f perfluoro fatty acids on xenobiotic-metabolizing enzymes, enzymes which detoxify reactive forms o f oxygen and lipid peroxidation in mouse liver. Biochemical Pharmacology 44:11831191. 44 Prevedouros, K., Cousins, I.T., Buck, R.C., and Korzeniowski, S.H. 2006. Sources, fate and transport o f perfluorocarboxylates. Environmental Science and Technology 40: 3244. Reid, T.S., Codding, D.W., and Bovey, F.A. 1955. Vinyl esters o f perfluoro acids. Journal o f Polymer Science 18: 417-421. Runkel, A.C., Tipping, R.G., Alexander, E.C., Jr., Green, J.A., Mossier, J.H., and Alexander, S.C. 2003, Hydrogeology o f the Paleozoic bedrock in southeastern Minnesota: Minnesota Geological Survey Report o f Investigations 61,105 p., 2 pis. Runkel, A.C., Mossier. J.H., and Tipping, R.G. 2007. The Lake Elmo downhole logging project: hydrostratigraphic characterization o f fractured bedrock at a perfluorochemical contamination site. Minnesota Geological Survey, St. Paul, Minnesota. November 1, 2007. Shapiro, A.M. (2008) Groundwater Flow and Chemical Transport in Fractured Rocks; USGS webinar, November 18,2008. So, M.K., Tamashita, N., Taniyasu, S., Jiang, Q., Giesy, J.P., Chen, K., and Lam, P.K..S. 2006. Health risks in infants associated with exposure to perfluorinated compounds in human breast milk from Zhoushan, China. Environmental Science and Technology 40: 2924-2929. Stiynar, M.J. and Lindstrom, A.B. 2008. Perfluorinated compounds in house dust from Ohio and North Carolina, USA. Environmental Science and Technology 42: 3751-3756. STS, 2007. Surface Water Quality Criterion for Perfluorooctanoic Acid. Prepared by STS Consultants, Inc. for the Minnesota Pollution Control Agency. August 2007. Accessed online at: http://www,pea.state.mu,us/hot/nfc.html#pfos Takagi, A., Sai, K., Umemura, T., Hasegawa, R., and Kurokawa, Y. 1991. Short-term exposure to the peroxisome proliferators, perfluorooctanoic acid and perfluorodecanoic acid, causes significant increase o f 8-hydroxydeoxyguanosine in liver DNA o f rats. Cancer Letters 57: 55-60. Tao, L., Kannan, K.., Wong, C.M., Arcaro, K.F., and Butenhoff, J.L. 2008. Perfluorinated compounds in human milk from Massachusetts, U.S.A. Environmental Science and Technology 42: 3096-3101. Tipping, RG., Runkel, A.C., Alexander, E.C., Jr., Alexander, S.C., and Green, J.A. (2006) Evidence for hydraulic heterogeneity and anisotropy in the mostly carbonate Prairie du Chien Group, southeastern Minnesota, USA. Sedimentary Geology, 184:305330. 45 p. 71 Tittlemier, S.A., Pepper, K., Seymour, C., Moisey, J., Bronson, R., Cao, X.L., and Dabeka, R.W. 2007. Dietary exposure o f Canadians to perfluorinated carboxylates and perfluorooctane sulfonate via consumption o f meat, fish, fast foods, and food items prepared in their packaging. Journal o f Agricultural and Food Chemistry 55: 3203-3210. UK Food Standards Agency 2006. Flourinated chemicals: UK dietary intakes. Food Standards Agency, Chemical Safety Division. London, United Kingdom, November 2006. Vestergren, R., Cousins, I.T., Trudel, D., Wormuth, M., and Scheringer, M. 2008. Estimating the contribution o f precursor compounds in consumer exposure to PFOS and PFOA. Chemosphere 73: 1617-1624. Weston 2005. Fluorochemical (FC) Site Related Environmental Assessment Program, 3M Cottage Grove, Minnesota Facility. Weston Solutions, Inc., West Chester, Pennsylvania, July 2005. Weston 2007a. Fluorochemical (FC) Assessment Work Plan for the 3M Woodbury Site. Weston Solutions, Inc., West Chester, Pennsylvania, February 2007. Weston 2007b. Hydraulic Evaluation o f the Barrier Well Recovery System - Former 3M Woodbury Disposal Site, Woodbury, MN. Weston Solutions, Inc., West Chester, Pennsylvania, September, 2007. Weston 2008a. Remedial Investigation / Feasibility Study, 3M Woodbury Disposal Site. Weston Solutions, Inc., West Chester, Pennsylvania, February 2008. Weston 2008b. Addendum 2 to the Feasibility Study for the Woodbury Site. Weston Solutions, Inc., West Chester, Pennsylvania, July 2008. Weston 2008c. Feasibility Study - Cottage Grove Site. Weston Solutions, Inc., West Chester, Pennsylvania, March 2008. Weston 2009. Gables Lake Surface Water Sampling Report, 3M Woodbury, MN Site. Weston Solutions, Inc., West Chester, Pennsylvania, July 2009. 46 Preparers of Report James Kelly, M.S. Health Assessor Site Assessment and Consultation Unit Minnesota Department o f Health Telephone: (651) 201-4910 James.Kellv@state.inn.us Virginia Yingling, M S. Hydrogeologist Site Assessment and Consultation Unit Minnesota Department o f Health Telephone: (651) 201-4930 Virginia.Yinqlinq@state.mn.us p. 72 47 CERTIFICATION This Public Health Assessment was prepared by the Minnesota Department o f Health under a cooperative agreement with the Agency for Toxic Substances and Disease Registry (ATSDR). It is in accordance with approved methodology and procedures existing at the time the Public Health Assessment was begun. Editorial review was completed by the Cooperative Agreement partner. The Division o f Health Assessment and Consultation, ATSDR, has reviewed this PublicHealth Assessment and concurs with the findings. Glossary Absorption The process o f taking in. For a person or an animal, absorption is the process o f a substance getting into the body through the eyes, skin, stomach, intestines, or lungs. Acute Occurring over a short time [compare with chronic]. Acute exposure Contact with a substance that occurs once or for only a short time (up to 14 days) [compare with intermediate duration exposure and chronic exposure]. Additive effect A biologic response to exposure to multiple substances that equals the sum o f responses o f all the individual substances added together [compare with antagonistic effect and synergistic effect]. Adverse health effect A change in body function or cell structure that might lead to disease or health problems. Ambient Surrounding (for example, ambient air). Analyte A substance measured in the laboratory. A chemical for which a sample (such as water, air, or blood) is tested in a laboratory. For example, if the analyte is mercury, the laboratory test will determine the amount o f mercury in the sample. Analytic epidemiologic study A study that evaluates the association between exposure to hazardous substances and disease by testing scientific hypotheses. Antagonistic effect A biologic response to exposure to multiple substances that is less than would be expected if the known effects o f the individual substances were added together [compare with additive effect and synergistic effect]. Aquifer A geologic unit (sediments, rock) in which the pore spaces are fully saturated with groundwater and that can yield water in usable quantities for springs or wells. Background level An average or expected amount o f a substance or radioactive material in a specific environment, or typical amounts o f substances that occur naturally in an environment. 49 p. 75 Bedrock valley A valley eroded into the bedrock by the action o f streams, glaciers, wind, etc. If the valley is subsequently filled with sediment (sand, gravel, silt, or clay), it is referred to as a buried valley or buried bedrock valley. Biodegradation Decomposition or breakdown o f a substance through the action o f microorganisms (such as bacteria or fungi) or other natural physical processes (such as sunlight). Biologic indicators of exposure study A study that uses (a) biomedical testing or (b) the measurement o f a substance [an analyte], its metabolite, or another marker o f exposure in human body fluids or tissues to confirm human exposure to a chemical substance [also see exposure investigation]. Biologic monitoring Measuring chemical substances in biologic materials (such as blood, hair, urine, or breath) to determine whether exposure has occurred. A blood test for lead is an example o f biologic monitoring. Biologic uptake The transfer o f substances from the environment to plants, animals, and humans. Biomedical testing Testing o f persons to find out whether a change in a body function might have occurred because of exposure to a chemical substance. Biota Plants and animals in an environment. Some o f these plants and animals might be sources o f food, clothing, or medicines for people. Body burden The total amount o f a substance in the body. Some substances build up in the body because they are stored in fat or bone or because they leave the body very slowly. Buried valley A bedrock valley that has been filled with sediment. See "bedrock valley". Cancer Any one o f a group o f diseases that occur when cells in the body become abnormal and grow or multiply out o f control. Cancer risk A theoretical risk for getting cancer if exposed to a substance every day for 70 years (a lifetime exposure). The true risk might be lower. 50 p. 76 Carcinogen A substance that causes cancer. Case study A medical or epidemiologic evaluation o f one person or a small group o f people to gather information about specific health conditions and past exposures. Case-control study A study that compares exposures o f people who have a disease or condition (cases) with people who do not have the disease or condition (controls). Exposures that are more common among the cases may be considered as possible risk factors for the disease. CAS registry number A unique number assigned to a substance or mixture by the American Chemical Society Abstracts Service. Central nervous system The part o f the nervous system that consists o f the brain and the spinal cord. CERCLA [see Comprehensive Environmental Response, Compensation, and Liability Act o f 1980], Chronic Occurring over a long time [compare with acute]. Chronic exposure Contact with a substance that occurs over a long time (more than 1 year) [compare with acute exposure and intermediate duration exposure]. Cluster investigation A review o f an unusual number, real or perceived, o f health events (for example, reports o f cancer) grouped together in time and location. Cluster investigations are designed to confirm case reports; determine whether they represent an unusual disease occurrence; and, if possible, explore possible causes and contributing environmental factors. Community Assistance Panel (CAP) A group o f people from a community and from health and environmental agencies who work with ATSDR to resolve issues and problems related to hazardous substances in the community. CAP members work with ATSDR to gather and review community health concerns, provide information on how people might have been or might now be exposed to hazardous substances, and inform ATSDR on ways to involve the community in its activities. Comparison value (CV) Calculated concentration o f a substance in air, water, food, or soil that is unlikely to cause harmful (adverse) health effects in exposed people. The CV is used as a screening level 51 p. 77 during the public health assessment process. Substances found in amounts greater than their CVs might be selected for further evaluation in the public health assessment process. Com pleted exposure pathway [see exposure pathway]. Comprehensive Environmental Response, Compensation, and Liability Act of 1980. (CERCLA) CERCLA, also known as Superfund, is the federal law that concerns the removal or cleanup o f hazardous substances in the environment and at hazardous waste sites. ATSDR, which was created by CERCLA, is responsible for assessing health issues and supporting public health activities related to hazardous waste sites or other environmental releases o f hazardous substances. This law was later amended by the Superfund Amendments and Reauthorization Act (SARA). Concentration The amount o f a substance present in a certain amount o f soil, water, air, food, blood, hair, urine, breath, or any other media. C on tam in an t A substance that is either present in an environment where it does not belong or is present at levels that might cause harmful (adverse) health effects. Delayed health effect A disease or an injury that happens as a result o f exposures that might have occurred in the past. Dermal Referring to the skin. For example, dermal absorption means passing through the skin. Dermal contact Contact with (touching) the skin [see route o f exposure]. Descriptive epidemiology The study o f the amount and distribution o f a disease in a specified population by person, place, and time. Detection limit The lowest concentration o f a chemical that can reliably be distinguished from a zero concentration. Disease prevention Measures used to prevent a disease or reduce its severity. 3 52 Disease registry A system o f ongoing registration o f ali cases o f a particular disease or health condition in a defined population. Dose (for chemicals that are not radioactive) The amount o f a substance to which a person is exposed over some time period. Dose is a measurement o f exposure. Dose is often expressed as milligram (amount) per kilogram (a measure of body weight) per day (a measure o f time) when people eat or drink contaminated water, food, or soil. In general, the greater the dose, the greater the likelihood o f an effect. An "exposure dose" is how much o f a substance is encountered in the environment An "absorbed dose" is the amount o f a substance that actually got into the body through the eyes, skin, stomach, intestines, or lungs. D ose (for radioactive chemicals) The radiation dose is the amount o f energy from radiation that is actually absorbed by the body. This is not the same as measurements o f the amount o f radiation in the environment. Dose-response relationship The relationship between the amount o f exposure [dose] to a substance and the resulting changes in body function or health (response). Downgradient A location "downstream" relative to groundwater flow directions, or the direction to which groundwater is flowing. Environmental media Soil, water, air, biota (plants and animals), or any other parts o f the environment that can contain contaminants. Environmental media and transport mechanism Environmental media include water, air, soil, and biota (plants and animals). Transport mechanisms move contaminants from the source to points where human exposure can occur. The environmental media and transport mechanism is the second part of an exposure pathway. EPA United States Environmental Protection Agency. Epidemiologic surveillance [see Public health surveillance]. Epidemiology The study o f the distribution and determinants o f disease or health status in a population; the study o f the occurrence and causes o f health effects in humans. Exposure 53 p. 79 Contact with a substance by swallowing, breathing, or touching the skin or eyes. Exposure may be short-term [acute], o f intermediate duration, or long-term [chronic]. Exposure assessment The process o f finding out how people come into contact with a chemical substance or environmental contaminant, how often and for how long they are in contact with the substance, and how much o f the substance they are in contact with. Exposure-dose reconstruction A method o f estimating the amount o f people's past exposure to environmental contaminants. Computer and approximation methods are used when past information is limited, not available, or missing. Exposure investigation The collection and analysis o f site-specific information and biologic tests (when appropriate) to determine whether people have been exposed to chemical substances. Exposure pathway The route a substance takes from its source (where it began) to its endpoint (where it ends), and how people can come into contact with (or get exposed to) it. An exposure pathway has five parts: a source o f contamination (such as an abandoned business); an environmental media and transport mechanism (such as movement through groundwater); a point o f exposure (such as a private well); a route o f exposure (eating, drinking, breathing, or touching), and a receptor population (people potentially or actually exposed). When all five parts are present, the exposure pathway is termed a completed exposure pathway. Exposure registry A system o f ongoing followup o f people who have had documented environmental exposures. Fault In geology, a fault is a planar rock feature which shows evidence o f relative movement. Feasibility study A study to determine the best way to clean up environmental contamination. A number of factors are considered, including health risk, costs, and what methods will work well. Gaining stream A stream into which groundwater enters through the stream banks and streambed. Compare to "losing stream". Geographic information system (GIS) A mapping system that uses computers to collect, store, manipulate, analyze, and display data. For example, GIS can show the concentration o f a contaminant within a community in relation to points o f reference such as streets and homes. 54 Grand rounds Training sessions for physicians and other health care providers about health topics. Groundwater Water beneath the earth's surface in the spaces between soil particles and between rock surfaces [compare with surface water]. Groundwater Divide The boundary between to groundwater "basins" where the water on one side flows toward one basin and the water on the other side flows to the other. This is similar in concept to a watershed divide or the continental divide for surface waters. Half-life (t>/4) The time it takes for half the original amount o f a substance to disappear. In the environment, the half-life is the time it takes for half die original amount o f a substance to disappear when it is changed to another chemical by bacteria, fungi, sunlight, or other chemical processes. In the human body, the half-life is the time it takes for half the original amount o f the substance to disappear, either by being changed to another substance or by leaving the body. In the case o f radioactive material, the half-life is the amount o f time necessary for one-half the initial number o f radioactive atoms to change or transform into another atom (that is normally not radioactive). After two half-lives, 25% o f the original number o f radioactive atoms remain. Hazard A source o f potential harm from past, current, or future exposures. Hazardous Substance Release and Health Effects Database (HazDat) The scientific and administrative database system developed by ATSDR to manage data collection, retrieval, and analysis o f site-specific information on hazardous substances, community health concerns, and public health activities. Health consultation A review o f available information or collection o f new data to respond to a specific health question or request for information about a potential environmental hazard. Health consultations are focused on a specific exposure issue. Health consultations are therefore more limited than a public health assessment, which reviews the exposure potential o f each pathway and chemical [compare with public health assessment]. Health education Programs designed with a community to help it know about health risks and how to reduce these risks. Health investigation The collection and evaluation o f information about the health o f community residents. This information is used to describe or count the occurrence o f a disease, symptom, or 55 p. 81 clinical measure and tp evaluate the possible association between the occurrence and exposure to chemical substances. Health promotion The process o f enabling people to increase control over, and to improve, their health. Health Base Value (HBV) A n MDH criteria, a HBV is the concentration o f a contaminant in water that is considered safe for people if they drink water daily for a lifetime. HBVs have not undergone the state's rule-making process. Health Risk Limit (HRL) A n MDH standard, a HRL is the concentration o f a contaminant in water that is considered safe for people if they drink water daily for a lifetime. Health statistics review The analysis o f existing health information (i.e., from death certificates, birth defects registries, and cancer registries) to determine if there is excess disease in a specific population, geographic area, and time period. A health statistics review is a descriptive epidemiologic study. Indeterminate public health hazard The category used in ATSDR's public health assessment documents when a professional judgment about the level o f health hazard cannot be made because information critical to such a decision is lacking. Incidence The number o f new cases o f disease in a defined population over a specific time period [contrast with prevalence]. Ingestion . The act o f swallowing something through eating, drinking, or mouthing objects. A chemical substance can enter the body this way [see route o f exposure]. Inhalation The act o f breathing. A chemical substance can enter the body this way [see route o f exposure]. Intermediate duration exposure Contact with a substance that occurs for more than 14 days and less than a year [compare with acute exposure and chronic exposure]. In vitro In an artificial environment outside a living organism or body. For example, some toxicity testing is done on cell cultures or slices o f tissue grown in the laboratory, rather than on a living animal [compare with in vivo]. 56 In vivo Within a living organism or body. For example, some toxicity testing is done on whole animals, such as rats or mice [compare with in vitro]. Losing stream A stream in which the surface water infiltrates through the stream banks and streambed, down into the groundwater. Such streams are often intermittent and may appear to be dry for much o f the summer, although water is still migrating within the streambed sediments. Compare to "gaining stream". Lowest-observed-adverse-effect level (LOAEL) The lowest tested dose o f a substance that has been reported to cause harmful (adverse) health effects in people or animals. MDH The Minnesota Department o f Health. Medical monitoring A set o f medical tests and physical exams specifically designed to evaluate whether an individual's exposure could negatively affect that person's health. Metabolism The conversion or breakdown o f a substance from one form to another by a living organism. M etabolite Any product o f metabolism, mg/kg Milligram per kilogram. mg/cm2 Milligram per square centimeter (o f a surface). mg/m3 Milligram per cubic meter; a measure o f the concentration o f a chemical in a known volume (a cubic meter) o f air, soil, or water. M igration Moving from one location to another. Minimal risk level (MRL) An ATSDR estimate o f daily human exposure to a environmental contaminant at or below which that substance is unlikely to pose a measurable risk o f harmful (adverse), noncancerous effects. MRLs are calculated for a route o f exposure (inhalation or oral) 57 p. 83 over a specified time period (acute, intermediate, or chronic). MRLs should not be used as predictors o f harmfiil (adverse) health effects [see reference dose]. M orbid ity State o f being ill or diseased. Morbidity is the occurrence o f a disease or condition that alters health and quality o f life. , M ortality Death. Usually the cause (a specific disease, a condition, or an injury) is stated. MPCA The Minnesota Pollution Control Agency. M utagen A substance that causes mutations (genetic damage). M utation A change (damage) to the DNA, genes, or chromosomes o f living organisms. National Priorities List for Uncontrolled Hazardous Waste Sites (National Priorities List or NPL) EPA's list o f the most serious uncontrolled or abandoned hazardous waste sites in the United States. The NPL is updated on a regular basis. National Toxicology Program (NTP) Part o f the Department o f Health and Human Services. NTP develops and carries out tests to predict whether a chemical will cause harm to humans. N o apparent public health hazard A category used in ATSDR's public health assessments for sites where human exposure to contaminated media might be occurring, might have occurred in the past, or might occur in the future, but where the exposure is not expected to cause any harmful health effects. No-observed-adverse-effect level (NOAEL) The highest tested dose o f a substance that has been reported to have no harmful (adverse) health effects on people or animals. No public health hazard A category used in ATSDR's public health assessment documents for sites where people have never and will never come into contact with harmful amounts o f site-related substances. NPL [see National Priorities List for Uncontrolled Hazardous Waste Sites] Physiologically based pharmacoidnetic model (PBPK model) 58 A computer model that describes what happens to a chemical in the body. This model describes how the chemical gets into the body, where it goes in the body, how it is changed by the body, and how it leaves the body. Pica A craving to eat nonfood items, such as dirt, paint chips, and clay. Some children exhibit pica-related behavior, PFC Perfluorochemical, a family o f fully fluorinated hydrocarbons. PLP Permanent List o f Priorities, the Minnesota state Superfund list Plume A volume o f a substance that moves from its source to places farther away from the source. Plumes can be described by the volume o f air or water they occupy and the direction they move. For example, a plume can be a column o f smoke from a chimney or a substance moving with groundwater. Point of exposure The place where someone can come into contact with a substance present in the environment [see exposure pathway]. Population A group or number o f people living within a specified area or sharing similar characteristics (such as occupation or age). Potentially responsible party (PRP) A company, government, or person legally responsible for cleaning up the pollution at a hazardous waste site under Superfiind. There may be more than one PRP for a particular site. PPb Parts per billion, ppm Parts per million. ppt Parts per trillion. Prevalence The number o f existing disease cases in a defined population during a specific time period [contrast with incidence]. 59 p. 85 Prevalence survey The measure o f the current level o f disease(s) or symptoms and exposures through a questionnaire that collects self-reported information from a define} population. Prevention Actions that reduce exposure or other risks, keep people from getting sick, or keep disease from getting worse. Public availability session An informal, drop-by meeting at which community members can meet one-on-one with ATSDR staff members to discuss health and site-related concerns. Public comment period An opportunity for the public to comment on agency findings or proposed activities contained in draft reports or documents. The public comment period is a limited time period during which comments will be accepted. Public health action A list o f steps to protect public health. Public health advisory A statement made by ATSDR to EPA or a state regulatory agency that a release o f hazardous substances poses an immediate threat to human health. The advisory includes recommended measures to reduce exposure and reduce the threat to human health. Public health assessment (PHA) A n ATSDR document that examines environmental contaminants, health outcomes, and community concerns at a waste site to determine whether people could be harmed from coming into contact with those contaminants. The PHA also lists actions that need to be taken to protect public health [compare with health consultation]. Public health hazard A category used in ATSDR's public health assessments for sites that pose a public health hazard because o f long-term exposures (greater than 1 year) to sufficiently high levels o f hazardous substances or radionuclides that could result in harmful health effects. Public health hazard categories Public health hazard categories are statements about whether people could be harmed by conditions present at the site in the past, present, or future. One or more hazard categories might be appropriate for each site. The five public health hazard categories are no public health hazard, no apparent public health hazard, indeterminate public health hazard, public health hazard, and urgent public health hazard. Public health statement The first chapter o f an ATSDR toxicological profile. The public health statement is a summary written in words that are easy to understand. The public health statement 60 explains how people might be exposed to a specific substance and describes the known health effects o f that substance. Public health surveillance The ongoing, systematic collection, analysis, and interpretation o f health data. This activity also involves timely dissemination o f the data and use for public health programs. Public meeting A public forum with community members for communication about a site. RCRA [see Resource Conservation and Recovery Act (1976,1984)] Receptor population People who could come into contact with environmental contaminants [see exposure pathway]. Reference dose (RfD) A n EPA estimate, with uncertainty or safety factors built in, o f the daily lifetime dose of a substance that is unlikely to cause harm in humans. Registry A systematic collection o f information on persons exposed to a specific substance or having specific diseases [see exposure registry and disease registry]. Remedial investigation The CERCLA process o f determining the type and extent o f hazardous material contamination at a site. Resource Conservation and Recovery Act (1976,1984) (RCRA) This Act regulates management and disposal o f hazardous wastes currently generated, treated, stored, disposed of, or distributed. RfD [see reference dose] Risk The probability that something will cause injury or harm. Risk reduction Actions that can decrease the likelihood that individuals, groups, or communities will experience disease or other health conditions. Risk communication The exchange o f information to increase understanding o f health risks. 61 p. 87 Route of exposure The way people come into contact with a hazardous substance or environmental contaminant. Three routes o f exposure are breathing [inhalation], eating or drinking [ingestion], or contact with the skin [dermal contact]. Safety factor [see uncertainty factor] SA RA [see Superfund Amendments and Reauthorization Act] Sample A portion or piece o f a whole. A selected subset o f a population or subset o f whatever is being studied. For example, in a study o f people the sample is a number o f people chosen from a larger population [see population]. An environmental sample (for example, a small amount o f soil or water) might be collected to measure contamination in the environment at a specific location. Sample size The number o f units chosen from a population or an environment. Saturated thickness The vertical thickness o f an aquifer in which all o f the available pore space is filled with water. Solvent A liquid capable o f dissolving or dispersing another substance (for example, acetone or mineral spirits). Source of contamination The place where an environmental contaminant comes from, such as a landfill, waste pond, incinerator, storage tank, or drum. A source o f contamination is the first part o f an exposure pathway. Special populations People who might be more sensitive or susceptible to exposure to environmental contaminants because o f factors such as age, occupation, sex, or behaviors (for example, cigarette smoking). Children, pregnant women, and older people are often considered special populations. Special Well Construction Area (SWCA) Minnesota Statutes, section 1031, subdivision 5, clause 7, grants the commissioner o f health the authority to establish standards for the construction, maintenance, sealing, and water quality monitoring o f wells in areas o f known or suspected contamination. Minnesota Rules, part 4725.3650, detail the requirements for construction, repair, or sealing within a designated SWCA, including plan review and approval, water quality monitoring, and other measures to protect public health and prevent degradation of groundwater. 62 p. 88 Stakeholder A person, group, or community who has an interest in activities at a waste site. Statistics A branch o f mathematics that deals with collecting, reviewing, summarizing, and interpreting data or information. Statistics are used to determine whether differences between study groups are meaningful. Substance A chemical. Substance-specific applied research A program o f research designed to fill important data needs for specific hazardous substances identified in ATSDR's toxicological profiles. Filling these data needs would allow more accurate assessment o f human risks from specific substances contaminating the environment. This research might include human studies or laboratory experiments to determine health effects resulting from exposure to a given hazardous substance. Superfund [see Comprehensive Environmental Response, Compensation, and Liability Act o f 1980 (CERCLA) and Superfund Amendments and Reauthorization Act (SARA) Superfund Amendments and Reauthorization Act (SARA) In 1986, SARA amended the Comprehensive Environmental Response, Compensation, and Liability Act o f 1980 (CERCLA) and expanded the health-related responsibilities o f ATSDR. CERCLA and SARA direct ATSDR to look into the health effects from substance exposures at hazardous waste sites and to perform activities including health education, health studies, surveillance, health consultations, and toxicological profiles. Surface water Water on the surface o f the earth, such as in lakes, rivers, streams, ponds, and springs [compare with groundwater]. Survey A systematic collection o f information or data. A survey can be conducted to collect information from a group o f people or from the environment. Surveys o f a group o f people can be conducted by telephone, by mail, or in person. Some surveys are done by interviewing a group o f people [see prevalence survey]. Synergistic effect A biologic response to multiple substances where one substance worsens the effect o f another substance. The combined effect o f the substances acting together is greater than the sum o f the effects o f the substances acting by themselves [see additive effect and antagonistic effect]. 63 Teratogen A substance that causes defects in development between conception and birth. A teratogen is a substance that causes a structural or functional birth defect. Toxic agent Chemical or physical (for example, radiation, heat, cold, microwaves) agents that, under certain circumstances o f exposure, can cause harmful effects to living organisms. Toxicological profile An ATSDR document that examines, summarizes, and interprets information about a hazardous substance to determine harmful levels o f exposure and associated health effects. A toxicological profile also identifies significant gaps in knowledge on die substance and describes areas where further research is needed. Toxicology The study o f the harmful effects of substances on humans or animals. Transmissivity In hydraulics, this is a measure o f the rate at which water moves through an aquifer or a defined portion o f an aquifer. Tumor An abnormal mass o f tissue that results from excessive cell division that is uncontrolled and progressive. Tumors perform no useful body function. Tumors can be either benign (not cancer) or malignant (cancer). Uncertainty factor Mathematical adjustments for reasons o f safety when knowledge is incomplete. For example, factors used in the calculation o f doses that are not harmful (adverse) to people. These factors are applied to the lowest-observed-adverse-effect-level (LOAEL) or the noobserved-adverse-effect-level (NOAEL) to derive a minimal risk level (MRL). Uncertainty factors are used to account for variations in people's sensitivity, for differences between animals and humans, and for differences between a LOAEL and a NOAEL. Scientists use uncertainty factors when they have some, but not all, the information from animal or human studies to decide whether an exposure will cause harm to people [also sometimes called a safety factor], Upgradient A location "upstream" relative to groundwater flow directions, or the direction from which groundwater is flowing. Urgent public health hazard A category used in ATSDR's public health assessments for sites where short-term exposures (less than 1 year) to hazardous substances or conditions could result in harmful health effects that require rapid intervention. 64 p. 90 Volatile organic compounds (VOCs) Organic compounds that evaporate readily into the air. VOCs include substances such as benzene, toluene, methylene chloride, and TCE. W ater table The subsurface layer below which all available pore space is completely saturated with groundwater. Other glossaries and dictionaries: U.S. Environmental Protection Agency ('http://www.epa.uov/OCEPAterms/1 National Center for Environmental Health/Agency for Toxic Substances and Disease Registry (CDC) ('http://www.cdc.gov/nceh/dls/report/ulossarv.htm') http://www.cdc.gov/exposurereport/ National Library of Medicine (NIH) ('http://www.nlm.nih.gov/inedlineplus/mplusdictionary.html') http://www.nlm.nih.gov/medlineplus/mplusdictionary.html For more information on the work of ATSDR, please contact: Office of Communications National Center for Environmental Health/Agency for Toxic Substances and Disease Registry 1600 Clifton Road, N.E. (MS E-29) Atlanta, GA 30333 Telephone: (404) 498-0080 65 Appendix 1: Figures p. 91 66 p. 92 FFFFFFFF O // F -- I--111I H--|-- s- O FFFFFFFF ^ Periluoro-octane sulfonate (PFOS) F F FF FF F F F FF FFFF O Perfluorooctanoic acid (PFOA) FFF I--IF -- ------- FFF Perfluorobutanoic acid (PFBA) Figure 2: Chemical structures of the major PFCs detected in the groundwater of southern Washington County, Minnesota. Figure 3 - 3M-Woodbury Disposal Site Well Location Map p. 93 $ Monitoring well Recovery well O Observation well Barrier well 69 3M-Woodbury Property Boundary Approx, location of PFC disposal areas Minnesota Dept, of Health -10/6/09 Legend I Quaternary St. Peter Prairie du Chien Jordan St. Lawrence " Franconia Ironton-Galesville -I-w? Area of isolated "pocket" of PFBA in the Jordan (Fig. 14) Vertical exaggeration = 20x Figure 4 - Cross-Section Across Highly Faulted Zone This figure shows a cross-sectional view of the bedrock along a transect (blue line in map) from Cottage Grove near Ravine Park and trending eastsoutheast to the St. Croix River. Many bedrock faults (show n in red) have disturbed the geology in this area, bringing different bedrock units into contact with one another. This may have allowed PFBA to move from one aquifer to another, creating what appear to be isolated "p o c k e ts " of contam ination when viewed on a map (such as Fig. 9). The arrows on the cross-section view show a hypothetical pathway that PFBA may have followed that would aiiow the contaminant to migrate from the Jordan into the Franconia and back into the Jordan again. Prepared by MDH - 8/26/09 70 p. 94 Legend 3M-Woodbury Disposal Site f I ; Platteville-Glenwood St. Peter fW/.\i|j Prairie du Chien ; Jordan Prepared by MDH - 8/5/09 This figure shows the upperm ost bedrock units that underlie the 3M-W oodbury Disposal Site (i.e. the first bedrock unit beneath the unconsofidated soil, sand, and clay near the surface). Note that from northeast to southwest across the site, successively deeper units are the "top" bedrock layer. The areas where the Prairie du Chien and Jordan are shown coincides with a major burled bedrock valley. 71 Figure 6: PFBA Levels in Cottage Grove Municipal Wells, 2007-2009 2.00 Well No. hb- 2 3 4 b B 9 10 11 ' V' ^ 2 r > r*- O Qo O U 8 a G8 cm CVJ CV CM CM a cft0*5 CO CO c*s ?5 0 5j jjp jg 1 \ Sm & : i 11 1 1 " 1-- -- j-- ' tf'wt'ii'''; ^ .-- J-- 'f11 i N . r*- oe o 8 O 8 8 CM CM CM CM cft*>. ( f t CO Q ) ci ao ft o CO 0 0 GO So o O oo 8 o CM CM CM CM CO CO cft cft S i C * ?5 oCO a o 0 0 0 0 o 8 88 8 CM CM ''-w CO CO c f t c f t r^ : oft cft o0 0 c <7> O ) O ) oo oU & 8o C J CM CM CM CO CO c f t cft cft S i S i cft i o O) o U CM --te c ft CO i?3 Sample Date p. 96 72 Figure 7 - PFBA in the St. Peter Legend M PFBA > 7 ppb PFBA = 3 . 5 - 7 ppb PFBA = 1 - 3.49 ppb PFBA = 0.1 - 0.99 ppb PFBA < 0.1 ppb * PFBA not detected bedrock valley O sampled well Note: in areas with no color coding, there were no wells in this aquifer to sample and insufficient information to fill in the PFBA concentrations, or the St. Peter is not present in this area. 73 Figure 8: PFBA in the Prairie du Chien Legend PFBA > 7 ppb PFBA = 3.5 - 7 ppb PFBA = 1 - 3.49 ppb ip j i PFBA = 0.1 - 0.99 ppb 1 PFBA < 0.1 ppb ? PFBA not detected bedrock valley -------- fault O sampled well Note: in areas with no color coding, there were no wells in this aquifer to sample and insufficient information to fill in the PFBA concentrations, or the Prairie du Chien is not present in this area. 74 Figure 9: PFBA in the Jordan Legend - ; PFBA = 3 .5 -6 .9 ppb PFBA = 1- 3.49 ppb , ' PFBA = 0.1 -0.99 ppb || | PFBA< 0.1 ppb PFBA not detected Bedrock valley ---------Fault O sampled well Note: in areas with no color coding, there were no wells in this aquifer to sample and insufficient information to fill in the PFBA concentrations. 75 p. 100 Figure 10: PFBA in the Franconia Legend PFBA = 1 - 3.49 ppb ^ - PFBA = 0.1 - 0.99 ppb f P I PFBA <0.1 ppb PFBA not detected J.0v; bedrock valley "- faults Note: in areas with no color coding, there were no wells in this aquifer to sample and insufficient information to fill in the PFBA concentrations. 76 %, T / . 77 Source. Weston 2QQ8n ft..-.'. . p. 101  GP,?: G P 102 ; PO g, I I AREA | SAMPLE SAMPLE 1LOCATION DEPTH (fVbgs.) RESULTS liM PFBA PTOA * ap.rpoosbl 1 Main DisposA/w GPAOf 3 104 547 6450 GPA02 a SI 1160 16600 GPA03 24 32 305 10M0 38 643 17600 A !3 3 106 960 20 9 113 305 GPA04 16.5 223 3020000 4340 GPA05 20 8 S 17000 691 2 43/ 2020 10.5 N 183 583 GPBO! , !2 ! 11? 1340 4330 B 1 \1 ' 2 ND ND GPBO? u I 33 1790 ND 1 GPCOl c GPC02 .I 1ft I a 4 2\ 1 1 !S 25 NO | 1$7 ND ND ND 129 145 2764 2 i 22 ND 197 rU\ GPD01 3 t2 4 NO 271 2 NO 379 GPEDt 12 | 50 $10 10900 1 19 NO ND | GPFOt M 3? 545 16640 F j 23 ! 2 .27 3 ND 256 ND 477 G ! GFG1 i 56 10.3 a ND 1840 ND ND NO H g PMUI IT3 20.5 53 ~33F 5490 ? NO 1200 MunicipalF i Area GPB1 _____________ i 3 ND NO ND 12 ND ND ND GP2 ie. 150 135 M3 24 62 154 ND SP3 14.5 9 182 712 29 7 334 201 J GPJ01 9.6 ND ND NO 13.5 ND ND NO I Concentrations reported as dry kvetght I ND-Not detected ato r above the Jrrvt o f quantitation. L ts e M q -3*cpfln>; Lcaftflt M a o D<toea< . v * 2c4stjrd*u V?> B<M>Maini co*rr C isfotilA scai. Source. Weston 2008a Figure 12 SOIL SAMPLE RESULTS FOR FORMER MAIN DISPOSAL AREA AND MUNICIPAL FILL AREAS 3M WOODBURY StTE WOODBURY, MN 78 "O Oro p. 103 Figure 13 - Areas Where Multiple PFCs Were Detected Legend Area with multiple PFCs Bedrock valley O Private well with drinking water advisory # Non-community public well with PFC levels that require treatment 79 Figure 14: Secondary Flow Paths in Fractured Rock The large Fast path of tracer movement ivo1Tmatrix diffusion is an artifact of fluid advecfion TIME 2 Slow path of tracer movement Tracer in slow slowly re-emerges into fast path fast path has moved on i f t i u : riiE^ijfh'E>j :L i^i' :i rlif.T > viv t WvCi-ii *j**J UJS i This figure from a tracer study performed by Shapiro (2008) illustrates the concept of primary anti secondary flow paths in fractured rock, like the Prairie du Chien in Washington County. The majority of contaminants in the aquifer quickly move through the primary (or "fast" ) flowpath, creating the first "pulse" of contaminant migration (shown as "Time 1"). This is followed by slower movement of the remaining contaminants through the secondary (or "slow") fiowpaths, resulting in a more dilute but longer lasting plume (shown as "Time 2"). 80 p. 104 Appendix 2: Tables p. 105 81 p. 106 Table 1: Initial 3M-Woodbury Disposal Site Monitoring Well Data1, 2005 -2 0 0 6 (in pg/L) Sample Location 2 B1 B2 B3 B4 M W -2 MW-3 MW-5 MW-7 MW-8 M W -11 CWM1 CW DS Aquifer 3 CJDN OPDC OPDC OPDC OPDC OSTP OPDC OSTP OPDC OPDC -- -- PFOS 0.056 0.069 ND* 0.095 0.109 1.83 - 2.29 NA7 NA NA NA NA NA 0 .9 1 6 1.23 1.28 -1 .3 8 PFOA 2 .2 6 -2 3 3 ND 0 .1 5 3 0.159 2 .7 8 -3 .1 2 NA NA NA NA NA NA 1.96 - 2.18 2 .6 1 -3 .2 2 PFBA 1.66 0.476 0.724 1.31 118 3.25 1.7 1.72 5.09 0.883 1.29 NA PFBS PFHxS 1 .8 3 -3 .4 7 2.31 2.61 ND 0.337 0.478 5 .7 2 -1 1 .0 NA NA NA NA NA NA 3 .5 1 -7 .2 6 ND 1 .0 3 - 1.20 19.7-23.3 NA NA NA NA NA NA 1 0 .3 -1 1 .6 3.40 - 7.34 7 .7 6 -9 .6 1 Notes: Values shown in boldface type exceed MDH drinking water criteria. No criteria exist for PFBS or PFHxS. 1Data are from Weston (2007a). Results are average values calculated from two samples from same well collected on same date 2Well locations are shown in Figure 4 3 Aquifer abbreviations: CJDN = Jordan, OPDC = Prairie du Chien, OSTP = St. Peter 4 Combined discharge from Woodbury pumping wells 5Non-contact process water discharge from retention pond at 3M-Chemolite Plant 6ND = not detected 7 NA = not analyzed 82 Table 2: General Results of 2007 Private and Business Well Sampling, results in ppb Aquifer No. of No. of Max. PFOA Max. Max. Max. Max. Max. Max. Wells Wells w/ (% wells) 1 PFOS (% PFBA(% PFPeA PFHxA PFBS (% PFHxS Sampled PFCs wells) wells) (% wells) (% wells) wells) (% wells) Detected Quaternary 12 9 ND ND 2.8 0.132 ND ND ND (75%) (17%) St. Peter 15 11 ND ND 2.5 0.091 ND ND ND ' Prairie du 173 163 (73%) (7%) 0.926 ND 3.3 0.205 0.218 ND ND Chien Prairie du 5 3 (_4%) (94%) (11%) (5%) ND ND 2.3 0.104 0.053 ND ND Chien - (60%) (20%) (20%) Jordan Jordan 307 217 0.3 0.1086 4.0 0.3 0.125 0.076 0.147 Franconia 88 10 (7%) ND (1%) ND (71%) 1.608 (14%) 0.108 (6%) ND (1%) ND (1%) ND (30%) (2%) Unknown 339 319 1.378 0.943 5.6 0.42 0.141 0.118 0.1645 Multiple 21 13 (18%) ND (1% )......_ (94%) ND 3.031 (62%) (51%) 0.172 (24%) (22%) 0.068 (14%) (2%) 0.1 (5%) (2%) ND Number in parentheses is the percent of wells in that aquifer in which the compound was detected at any concentration. 2ND - not detected in any well in this aquifer p. 107 83 Table 3: 3M-Woodbury Disposal Site Groundwater, 2007-2008 (in jig/L) Well B-l Date June 2007 March 2008 PFBA 1.59 1.79 PFPeA 0.487 0.509 PFHxA 0.974 0.847 PFHpA 0.143 0.128 PFOA 1.44 1.2 B-2 June 2007 0.471 ND ND ND ND March 2008 0.536 ND ND ND ND B-3 June 2007 0.728 0.074 0.119 ND 0.207 March 2008 0.769 0.0672 0.0946 ND 0.0202 B-4 MW-2 MW-4 June 2007 March 2008 June 2007 March 2008 June 2007 March 2008 1.5 1.69 126 71.5 0.809 0.873 0.406 0.447 9.31 9.14 0.062 0.0586 0.96 0.837 13 8.14 0.0537 0.0317 0.342 0.388 NR 1.51 0.0357 ND 2.44 2.94 4.92 3.47 0.0401 0.0269 MW-G MW-H June 2007 0.127 ND ND ND ND March 2008 0.201 ND ND ND ND June 2007 ND ND ND ND ND March 2008 ND ND ND ND ND SOUS June 2007 ND ND ND ND ND March 2008 0.0395 ND NR ND ND SOI PC S02DR S02JS S02PC S03JS June 2007 0.85 0.0347 0.0367 ND ND March 2008 0.942 0.0398 0.12 ND ND June 2007 0.594 0.0252 ND ND 0.033 March 2008 0.647 ND ND ND 0.0326 June 2007 ND ND ND ND ND March 2008 0.0360 ND ND ND ND June 2007 1.69 0.0573 0.0255 ND 0.0286 March 2008 1.2 0.0384 0.0403 ND ND June 2007 0.272 ND ND ND ND March 2008 0.233 ND ND ND ND PFBS 1.73 1.75 ND ND 0.362 0.429 3.48 3.84 14.4 9.15 0.216 0.124 ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND PFHxS 1.52 1.39 ND ND 1.29 1.43 11.5 13.9 4.65 2.06 0.433 0.267 ND ND ND ND ND ND ND ND 0.0373 0.0499 ND ND 0.0526 0.0435 ND ND PFOS ND 0.041 ND ND 0.171 0.156 1.78 3.06 ND 0.0361 0.172 0.104 0.114 ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND p. 108 84 Well Date PFB S03PC June 2007 March 2008 0.71 0.67 S04PC June 2007 0.335 March 2008 0.643 S04SP June 2007 1.14 March 2008 1.58 S05JS June 2007 ND March 2008 ND S05PC June 2007 0.393 March 2008 0.55 S05SP June 2007 March 2008 0.438 0.917 S06JS June 2007 ND March 2008 ND S06PC June 2007 1.1 March 2008 0.868 S07JS June 2007 March 2008 ND ND S07PC June 2007 0.984 March 2008 0.756 S07SP June 2007 0.58 March 2008 0.839 S08JS June 2007 March 2008 0.353 0.309 S08PC June 2007 0.122 March 2008 0.100 S09JS June 2007 ND March 2008 ND Data from: Weston (2007b) and Weston (2008b) PFPeA PFHxA PFHpA ND ND ND ND ND ND ND ND ND ND 0.0418 ND 0.0557 ND ND 0.041 0.0357 ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND 0.0308 ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND 0.0317 ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND = not detected PFOA PFBS PFHxS ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND NR = not reportable PFOS ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND p. 109 85 Table 4: Range of PFC Concentrations in Cottage Grove City Wei s (in ppb/U Well PFBA PFPcA PFHxA PFOA PFBS PFHxS - No. 1 0.6-1.02 ND ND ND ND ND 2 0.38-1.0 ND ND ND ND ND 3 0.89-1.4 ND -0 .0 7 ND ND 0.1 -0.25 ND - 0.14 4 0.75-1.22 ND - 0.07 ND - 0.56a ND 0.1-0.32 ND - 0.21 5 1.14-1.79 ND - 0.07 ND ND ND ND 6 0.77-1.34 ND ND ND N D -0.17 ND - 0.07 7 0.98-1.74 ND - 0.06b N D -0 .0 5 3 ND N D -0.16b ND $ 0.95-1.36 ND - 0.07 N D -0.063 ND ND - 0.09a N D -0 .1 4 3 9 0.83-1.02 ND ND ND ND ND 10 0.94-1.23 ND ND ND ND ND 11 0 .3 -0 .6 ND ND ND ND ND PFOS ND ND ND ND ND ND ND ND ND ND ND a - This compound detected in only one sample from this well since November 2006 Notes:*5- This compound detected in only two samples from this well since November 2006 p.110 86